Changqing Wang
| Snapshot Date: 2025-06-12 13:25 -0400 (Thu, 12 Jun 2025) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: devel |
| git_last_commit: c84f0e7 |
| git_last_commit_date: 2025-06-12 05:14:53 -0400 (Thu, 12 Jun 2025) |
| Back to Multiple platform build/check report for BioC 3.22: simplified long |
|
This page was generated on 2025-06-13 12:08 -0400 (Fri, 13 Jun 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 24.04.2 LTS) | x86_64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4797 |
| palomino8 | Windows Server 2022 Datacenter | x64 | 4.5.0 (2025-04-11 ucrt) -- "How About a Twenty-Six" | 4538 |
| lconway | macOS 12.7.1 Monterey | x86_64 | 4.5.0 Patched (2025-04-21 r88169) -- "How About a Twenty-Six" | 4571 |
| kjohnson3 | macOS 13.7.1 Ventura | arm64 | 4.5.0 Patched (2025-04-21 r88169) -- "How About a Twenty-Six" | 4515 |
| taishan | Linux (openEuler 24.03 LTS) | aarch64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4483 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 727/2309 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.3.2 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 24.04.2 LTS) / x86_64 | OK | OK | OK | | ||||||||
| palomino8 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | | ||||||||
| kjohnson3 | macOS 13.7.1 Ventura / arm64 | OK | OK | OK | OK | | ||||||||
| taishan | Linux (openEuler 24.03 LTS) / aarch64 | ERROR | ERROR | skipped | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.3.2 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.2.tar.gz |
| StartedAt: 2025-06-12 20:46:00 -0400 (Thu, 12 Jun 2025) |
| EndedAt: 2025-06-12 20:57:04 -0400 (Thu, 12 Jun 2025) |
| EllapsedTime: 664.2 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.2.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.0 Patched (2025-04-21 r88169)
* using platform: x86_64-apple-darwin20
* R was compiled by
Apple clang version 14.0.0 (clang-1400.0.29.202)
GNU Fortran (GCC) 14.2.0
* running under: macOS Monterey 12.7.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.3.2’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 49 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable. Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
installed size is 13.4Mb
sub-directories of 1Mb or more:
bin 8.3Mb
data 1.8Mb
libs 1.8Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for ‘new’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
‘which_label’
find_variants_grange: no visible binding for global variable
‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable
‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
reads’
plot_demultiplex_raw: no visible binding for global variable
‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
match reads’
plot_demultiplex_raw: no visible binding for global variable
‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible global function definition for
‘as’
sc_transcript_usage_chisq: no visible binding for global variable
‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘total’
sc_transcript_usage_permutation: no visible binding for global variable
‘test’
sc_transcript_usage_permutation: no visible global function definition
for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
‘cell_total_reads’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
Undefined global functions or variables:
BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count as
bam_index barcode barcode_rank capture.output cell_total_reads
chisq.test count counts_no_ins cumpct demultiplexed reads
download.file everything expr filter_res head imageX imageY in_tissue
input length_bin max_length min_length multi-matching reads
mutation_index n_reads na.omit name new nucleotide output p.value
packageVersion pct pos read1_with_adapter read_counts ref
scale_alpha_continuous scale_colour_gradient single match reads
starts_with test total total reads total_counts tr_length transcript
undemultiplexted reads unzip value which_label x y
Consider adding
importFrom("base", "match", "single")
importFrom("methods", "as", "new")
importFrom("stats", "chisq.test", "na.omit")
importFrom("utils", "capture.output", "download.file", "head",
"packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs/FLAMES.so’:
Found ‘___assert_rtn’, possibly from ‘assert’ (C)
Found ‘___stderrp’, possibly from ‘stderr’ (C)
Found ‘___stdoutp’, possibly from ‘stdout’ (C)
Found ‘_abort’, possibly from ‘abort’ (C)
Found ‘_exit’, possibly from ‘exit’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
plot_isoform_reduced_dim 25.491 0.438 26.160
find_variants 24.811 0.428 24.701
sc_long_multisample_pipeline 20.424 2.848 20.134
MultiSampleSCPipeline 19.021 2.348 22.714
sc_DTU_analysis 11.479 1.195 11.364
blaze 8.258 1.246 10.211
create_sce_from_dir 7.836 1.333 7.926
plot_isoform_heatmap 8.013 0.441 8.516
SingleCellPipeline 6.828 0.834 6.211
BulkPipeline 6.718 0.756 8.220
sc_long_pipeline 6.642 0.816 6.101
bulk_long_pipeline 4.553 0.907 4.202
create_se_from_dir 4.129 0.668 5.199
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 3 NOTEs
See
‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.3.2’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
unsigned int end;
^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o
clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2 -Wno-unused-result" minimap2)
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -DHAVE_KALLOC ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
cc -falign-functions=64 -Wall -g -O2 -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
Updating crates.io index
Installing oarfish v0.8.0
Updating crates.io index
Locking 263 packages to latest compatible versions
Adding noodles-bam v0.78.0 (available: v0.81.0)
Adding noodles-bgzf v0.38.0 (available: v0.41.0)
Adding noodles-sam v0.74.0 (available: v0.77.0)
Adding tabled v0.18.0 (available: v0.20.0)
Compiling libc v0.2.172
Compiling proc-macro2 v1.0.95
Compiling unicode-ident v1.0.18
Compiling autocfg v1.4.0
Compiling shlex v1.3.0
Compiling cfg-if v1.0.1
Compiling pkg-config v0.3.32
Compiling libm v0.2.15
Compiling memchr v2.7.5
Compiling zerocopy v0.8.25
Compiling crossbeam-utils v0.8.21
Compiling once_cell v1.21.3
Compiling version_check v0.9.5
Compiling adler2 v2.0.1
Compiling static_assertions v1.1.0
Compiling zlib-rs v0.5.1
Compiling typenum v1.18.0
Compiling serde v1.0.219
Compiling getrandom v0.3.3
Compiling pin-project-lite v0.2.16
Compiling regex-syntax v0.8.5
Compiling either v1.15.0
Compiling equivalent v1.0.2
Compiling futures-core v0.3.31
Compiling rawpointer v0.2.1
Compiling hashbrown v0.15.4
Compiling paste v1.0.15
Compiling futures-sink v0.3.31
Compiling pin-utils v0.1.0
Compiling heck v0.5.0
Compiling zstd-safe v7.2.4
Compiling semver v1.0.26
Compiling futures-io v0.3.31
Compiling vcpkg v0.2.15
Compiling futures-task v0.3.31
Compiling bitflags v2.9.1
Compiling bytecount v0.6.9
Compiling zstd-safe v6.0.6
Compiling regex-syntax v0.6.29
Compiling snap v1.1.1
Compiling itoa v1.0.15
Compiling rustversion v1.0.21
Compiling lazy_static v1.5.0
Compiling bytes v1.10.1
Compiling utf8parse v0.2.2
Compiling rustix v1.0.7
Compiling rayon-core v1.12.1
Compiling byteorder v1.5.0
Compiling lexical-util v1.0.6
Compiling unicode-width v0.2.1
Compiling crc32fast v1.4.2
Compiling miniz_oxide v0.8.9
Compiling anyhow v1.0.98
Compiling anstyle-parse v0.2.7
Compiling overload v0.1.1
Compiling is_terminal_polyfill v1.70.1
Compiling ryu v1.0.20
Compiling futures-channel v0.3.31
Compiling smallvec v1.15.1
Compiling portable-atomic v1.11.1
Compiling bit-vec v0.8.0
Compiling array-init-cursor v0.2.1
Compiling anstyle v1.0.11
Compiling log v0.4.27
Compiling fallible-streaming-iterator v0.1.9
Compiling tracing-core v0.1.34
Compiling serde_json v1.0.140
Compiling anstyle-query v1.1.3
Compiling colorchoice v1.0.4
Compiling thiserror v1.0.69
Compiling planus v0.3.1
Compiling thread_local v1.1.8
Compiling nu-ansi-term v0.46.0
Compiling streaming-decompression v0.1.2
Compiling itertools v0.13.0
Compiling sharded-slab v0.1.7
Compiling generic-array v0.14.7
Compiling ahash v0.8.12
Compiling twox-hash v1.6.3
Compiling seq-macro v0.3.6
Compiling fnv v1.0.7
Compiling strsim v0.11.1
Compiling fastrand v2.3.0
Compiling cpufeatures v0.2.17
Compiling clap_lex v0.7.5
Compiling num-traits v0.2.19
Compiling matrixmultiply v0.3.10
Compiling slab v0.4.9
Compiling num-complex v0.2.4
Compiling anstream v0.6.19
Compiling papergrid v0.14.0
Compiling itertools v0.14.0
Compiling number_prefix v0.4.0
Compiling ethnum v1.5.2
Compiling base64 v0.21.7
Compiling streaming-iterator v0.1.9
Compiling aho-corasick v1.1.3
Compiling buffer-redux v1.0.2
Compiling lexical-parse-integer v1.0.5
Compiling lexical-write-integer v1.0.5
Compiling tracing-log v0.2.0
Compiling clap_builder v4.5.40
Compiling rustc_version v0.4.1
Compiling lz4_flex v0.10.0
Compiling csv-core v0.1.12
Compiling arrayvec v0.7.6
Compiling lexical-parse-float v1.0.5
Compiling foreign_vec v0.1.0
Compiling simdutf8 v0.1.5
Compiling hash_hasher v2.0.4
Compiling dyn-clone v1.0.19
Compiling indexmap v2.9.0
Compiling arrow2 v0.18.0
Compiling base64 v0.22.1
Compiling hex v0.4.3
Compiling rustc-hash v2.1.1
Compiling atomic_float v1.1.0
Compiling parse-size v1.1.0
Compiling path-tools v0.1.0
Compiling lexical-write-float v1.0.5
Compiling num-format v0.4.4
Compiling crossbeam-channel v0.5.15
Compiling crossbeam-epoch v0.9.18
Compiling crossbeam-queue v0.3.12
Compiling quote v1.0.40
Compiling lexical-core v1.0.5
Compiling syn v2.0.102
Compiling getrandom v0.2.16
Compiling errno v0.3.12
Compiling console v0.15.11
Compiling num_cpus v1.17.0
Compiling jobserver v0.1.33
Compiling proc-macro-error-attr2 v2.0.0
Compiling crossbeam-deque v0.8.6
Compiling rand_core v0.9.3
Compiling rand_core v0.6.4
Compiling cc v1.2.26
Compiling crossbeam v0.8.4
Compiling indicatif v0.17.11
Compiling rayon v1.10.0
Compiling regex-automata v0.1.10
Compiling block-buffer v0.10.4
Compiling crypto-common v0.1.6
Compiling digest v0.10.7
Compiling regex-automata v0.4.9
Compiling zstd-sys v2.0.15+zstd.1.5.7
Compiling bzip2-sys v0.1.13+1.0.8
Compiling liblzma-sys v0.3.13
Compiling libz-sys v1.1.22
Compiling sha2-asm v0.6.4
Compiling lz4-sys v1.11.1+lz4-1.10.0
Compiling minimap2-sys v0.1.21+minimap2.2.28
Compiling tempfile v3.20.0
Compiling num-integer v0.1.46
Compiling num-complex v0.4.6
Compiling approx v0.5.1
Compiling noisy_float v0.2.0
Compiling approx v0.3.2
Compiling chrono v0.4.41
Compiling libz-rs-sys v0.5.1
Compiling flate2 v1.1.2
Compiling num-bigint v0.4.6
Compiling num-iter v0.1.45
Compiling matchers v0.1.0
Compiling bzip2 v0.4.4
Compiling ppv-lite86 v0.2.21
Compiling alga v0.9.3
Compiling sha2 v0.10.9
Compiling hashbrown v0.14.5
Compiling noodles-bgzf v0.38.0
Compiling ndarray v0.16.1
Compiling ndarray v0.15.6
Compiling rand_chacha v0.3.1
Compiling rand_chacha v0.9.0
Compiling liblzma v0.3.6
Compiling rand v0.9.1
Compiling rand v0.8.5
Compiling rand_distr v0.4.3
Compiling num-rational v0.4.2
Compiling num v0.4.3
Compiling proc-macro-error2 v2.0.1
Compiling serde_derive v1.0.219
Compiling bytemuck_derive v1.9.3
Compiling futures-macro v0.3.31
Compiling async-trait v0.1.88
Compiling async-stream-impl v0.3.6
Compiling tracing-attributes v0.1.29
Compiling thiserror-impl v1.0.69
Compiling derive-new v0.6.0
Compiling clap_derive v4.5.40
Compiling typed-builder-macro v0.21.0
Compiling strum_macros v0.26.4
Compiling tabled_derive v0.10.0
Compiling bstr v1.12.0
Compiling regex v1.11.1
Compiling async-stream v0.3.6
Compiling futures-util v0.3.31
Compiling tabled v0.18.0
Compiling bytemuck v1.23.1
Compiling tracing v0.1.41
Compiling noodles-core v0.17.0
Compiling typed-builder v0.21.0
Compiling lz4 v1.28.1
Compiling noodles-csi v0.46.0
Compiling safe_arch v0.7.4
Compiling noodles-sam v0.74.0
Compiling clap v4.5.40
Compiling tracing-subscriber v0.3.19
Compiling wide v0.7.32
Compiling noodles-bam v0.78.0
Compiling futures-executor v0.3.31
Compiling simba v0.9.0
Compiling futures v0.3.31
Compiling parquet-format-safe v0.2.4
Compiling ndarray-stats v0.6.0
Compiling sprs v0.11.3
Compiling zstd v0.12.4
Compiling zstd v0.13.3
Compiling needletail v0.6.3
Compiling bincode v1.3.3
Compiling arrow-format v0.8.1
Compiling csv v1.3.1
Compiling bio-types v1.0.4
Compiling kders v0.1.1
Compiling minimap2 v0.1.23+minimap2.2.28
Compiling sendable-swapvec v0.4.3
Compiling seqcol_rs v0.4.1
Compiling parquet2 v0.17.2
Compiling nalgebra v0.33.2
Compiling statrs v0.18.0
Compiling oarfish v0.8.0
Finished `release` profile [optimized] target(s) in 1m 26s
Installing cargo_temp/bin/oarfish
Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.0 Patched (2025-04-21 r88169) -- "How About a Twenty-Six"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/Rtmp2NX7Nb/filec8ce5d998e66/config_file_51406.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce5ebbfe72/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce78d5bb5f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce78d5bb5f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmp2NX7Nb/filec8ce4ef7ded4/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce4ef7ded4/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce4ef7ded4/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce4ef7ded4/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce3d36b284/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce3d36b284/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmp2NX7Nb/filec8ce7554037/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce7554037/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce7554037/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmp2NX7Nb/filec8ce7554037/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce3d36b284/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmp2NX7Nb/filec8ce186cca19/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ]
>
> proc.time()
user system elapsed
21.851 1.400 23.404
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| BulkPipeline | 6.718 | 0.756 | 8.220 | |
| MultiSampleSCPipeline | 19.021 | 2.348 | 22.714 | |
| SingleCellPipeline | 6.828 | 0.834 | 6.211 | |
| add_gene_counts | 0.327 | 0.009 | 0.338 | |
| annotation_to_fasta | 0.758 | 0.014 | 0.776 | |
| blaze | 8.258 | 1.246 | 10.211 | |
| bulk_long_pipeline | 4.553 | 0.907 | 4.202 | |
| combine_sce | 0.946 | 0.085 | 1.043 | |
| convolution_filter | 0.001 | 0.001 | 0.001 | |
| create_config | 0.006 | 0.001 | 0.008 | |
| create_sce_from_dir | 7.836 | 1.333 | 7.926 | |
| create_se_from_dir | 4.129 | 0.668 | 5.199 | |
| cutadapt | 0.165 | 0.063 | 0.257 | |
| example_pipeline | 0.434 | 0.043 | 0.511 | |
| experiment | 3.408 | 0.392 | 4.277 | |
| filter_annotation | 0.719 | 0.012 | 0.739 | |
| filter_coverage | 1.956 | 0.238 | 2.306 | |
| find_barcode | 1.176 | 0.231 | 1.472 | |
| find_bin | 0.007 | 0.009 | 0.030 | |
| find_variants | 24.811 | 0.428 | 24.701 | |
| get_coverage | 1.738 | 0.206 | 2.079 | |
| mutation_positions | 1.663 | 0.028 | 1.705 | |
| plot_coverage | 2.987 | 0.264 | 3.352 | |
| plot_demultiplex | 2.294 | 0.396 | 2.827 | |
| plot_demultiplex_raw | 1.269 | 0.090 | 1.390 | |
| plot_isoform_heatmap | 8.013 | 0.441 | 8.516 | |
| plot_isoform_reduced_dim | 25.491 | 0.438 | 26.160 | |
| plot_isoforms | 3.551 | 0.038 | 3.616 | |
| resume_FLAMES | 3.379 | 0.386 | 4.047 | |
| run_FLAMES | 3.258 | 0.365 | 3.943 | |
| run_step | 1.280 | 0.198 | 1.562 | |
| sc_DTU_analysis | 11.479 | 1.195 | 11.364 | |
| sc_impute_transcript | 0.697 | 0.012 | 0.715 | |
| sc_long_multisample_pipeline | 20.424 | 2.848 | 20.134 | |
| sc_long_pipeline | 6.642 | 0.816 | 6.101 | |
| sc_mutations | 3.271 | 0.370 | 3.087 | |
| show-FLAMESPipeline | 0.399 | 0.035 | 0.468 | |
| steps-set | 0.543 | 0.040 | 0.616 | |
| steps | 0.184 | 0.034 | 0.244 | |
| weight_transcripts | 0.026 | 0.021 | 0.047 | |