Multiple platform build/check report for BioC 3.22 - CHECK results for FLAMES on lconway

Hostname	OS	Arch (*)	R version	Installed pkgs
nebbiolo2	Linux (Ubuntu 24.04.2 LTS)	x86_64	4.5.1 (2025-06-13) -- "Great Square Root"	4818
palomino8	Windows Server 2022 Datacenter	x64	4.5.1 (2025-06-13 ucrt) -- "Great Square Root"	4553
lconway	macOS 12.7.1 Monterey	x86_64	4.5.1 (2025-06-13) -- "Great Square Root"	4595
kjohnson3	macOS 13.7.1 Ventura	arm64	4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root"	4537
Click on any hostname to see more info about the system (e.g. compilers) () as reported by 'uname -p', except on Windows and Mac OS X*

CHECK results for FLAMES on lconway

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results

Summary

Package: FLAMES

Version: 2.3.4

Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.4.tar.gz

StartedAt: 2025-08-08 21:03:34 -0400 (Fri, 08 Aug 2025)

EndedAt: 2025-08-08 21:33:17 -0400 (Fri, 08 Aug 2025)

EllapsedTime: 1783.2 seconds

RetCode: 0

Status: OK

CheckDir: FLAMES.Rcheck

Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.4.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.1 (2025-06-13)
* using platform: x86_64-apple-darwin20
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Monterey 12.7.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.3.4’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 50 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  5.5Mb
  sub-directories of 1Mb or more:
    data   1.8Mb
    libs   1.8Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification'
  'minimap2_align' 'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for ‘new’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable
  ‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_file’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
  Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count as
  bam_index barcode barcode_rank barcodes_file capture.output
  cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed
  reads demultiplexed_fastq download.file everything expect_cell_number
  expr fastq filter_res genome_bam head imageX imageY in_tissue input j
  length_bin max_length min_length minimap2 multi-matching reads
  mutation_index n_reads na.omit name new nucleotide outdir output
  p.value packageVersion pct pos read1_with_adapter read_counts ref
  samtools scale_alpha_continuous scale_colour_gradient single match
  reads starts_with test threads total total reads total_counts
  tr_length transcript transcriptome_assembly transcriptome_bam
  undemultiplexted reads unzip value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
plot_isoform_reduced_dim     26.918  0.412  27.597
find_variants                24.848  0.573  25.032
sc_long_multisample_pipeline 20.377  2.876  19.949
MultiSampleSCPipeline        18.523  2.165  22.023
sc_DTU_analysis              11.915  1.276  11.875
blaze                         8.776  1.379  10.955
plot_isoform_heatmap          9.369  0.537  10.143
SingleCellPipeline            7.422  0.937   6.854
create_sce_from_dir           6.821  1.254   6.755
sc_long_pipeline              6.968  0.885   6.413
BulkPipeline                  5.497  0.721   6.760
bulk_long_pipeline            5.121  1.012   5.027
create_se_from_dir            4.198  0.765   5.437
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 4 NOTEs
See
  ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.3.4’
** using non-staged installation via StagedInstall field
** libs
/bin/sh: rustc: command not found
using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
/bin/sh: rustc: command not found
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
  unsigned int end;
               ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2  -Wno-unused-result" minimap2)
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -DHAVE_KALLOC  ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
cc -falign-functions=64 -Wall -g -O2  -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Cargo not found, skipping oarfish installation.
installing to /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.5.1 (2025-06-13) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede165246aa33/config_file_56854.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede166a0ab33b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16210121d5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16210121d5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1670207cd6/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1670207cd6/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1670207cd6/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1670207cd6/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1648975f26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1648975f26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede16155f992b/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede16155f992b/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede16155f992b/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede16155f992b/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1648975f26/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1623d19804/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede165287078c/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:15:08 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmph7B7OO/filede165287078c/sample1_align2genome.bam
[M::mm_idx_gen::0.001*4.62] collected minimizers
[M::mm_idx_gen::0.002*3.18] sorted minimizers
[M::main::0.002*3.12] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.97] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.78] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.210*1.00] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165287078c/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165287078c/rps24.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample1.fq.gz
[M::main] Real time: 0.212 sec; CPU: 0.211 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/Rtmph7B7OO/filede165287078c/sample2_align2genome.bam
[M::mm_idx_gen::0.001*4.58] collected minimizers
[M::mm_idx_gen::0.002*3.19] sorted minimizers
[M::main::0.002*3.10] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.97] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.86] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.192*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165287078c/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165287078c/rps24.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample2.fq.gz
[M::main] Real time: 0.193 sec; CPU: 0.195 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/Rtmph7B7OO/filede165287078c/sample3_align2genome.bam
[M::mm_idx_gen::0.001*4.07] collected minimizers
[M::mm_idx_gen::0.002*2.87] sorted minimizers
[M::main::0.002*2.83] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.71] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.61] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.380*1.00] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165287078c/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165287078c/rps24.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample3.fq.gz
[M::main] Real time: 0.381 sec; CPU: 0.379 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Aug  8 21:15:10 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%[21:15:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[21:15:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[21:15:17] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[21:15:18] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[21:15:20] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[21:15:20] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.


  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:15:42 2025 -------------------
Realigning sample sample1 -> /tmp/Rtmph7B7OO/filede165287078c/sample1_realign2transcript.bam
[M::mm_idx_gen::0.001*4.34] collected minimizers
[M::mm_idx_gen::0.002*3.24] sorted minimizers
[M::main::0.002*3.14] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*3.05] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.97] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.092*1.03] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165287078c/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample1.fq.gz
[M::main] Real time: 0.093 sec; CPU: 0.096 sec; Peak RSS: 0.004 GB
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/Rtmph7B7OO/filede165287078c/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*5.59] collected minimizers
[M::mm_idx_gen::0.001*4.28] sorted minimizers
[M::main::0.001*4.12] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.98] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.82] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.099*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165287078c/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample2.fq.gz
[M::main] Real time: 0.099 sec; CPU: 0.103 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/Rtmph7B7OO/filede165287078c/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*5.29] collected minimizers
[M::mm_idx_gen::0.001*3.92] sorted minimizers
[M::main::0.001*3.75] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*3.59] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*3.40] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.189*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165287078c/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165287078c/fastq/sample3.fq.gz
[M::main] Real time: 0.190 sec; CPU: 0.193 sec; Peak RSS: 0.006 GB
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Aug  8 21:15:42 2025 ----------
[2m2025-08-09T01:15:42.754062Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:15:42.754673Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede165287078c/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:15:42.754713Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:15:42.754723Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:15:42.754961Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:15:42.754997Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:15:42.757451Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:15:42.757721Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:15:42.757771Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116
[2m2025-08-09T01:15:42.757779Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96
[2m2025-08-09T01:15:42.757785Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-08-09T01:15:42.762697Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:15:42.840069Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:15:42.840576Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede165287078c/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:15:42.840629Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:15:42.840639Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:15:42.840735Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:15:42.840748Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:15:42.843041Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:15:42.843304Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:15:42.843385Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114
[2m2025-08-09T01:15:42.843393Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95
[2m2025-08-09T01:15:42.843399Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82
[2m2025-08-09T01:15:42.847280Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:15:42.963153Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:15:42.963888Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede165287078c/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:15:42.963935Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:15:42.963951Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:15:42.964110Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:15:42.964128Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:15:42.968657Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2025-08-09T01:15:42.969020Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:15:42.969065Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239
[2m2025-08-09T01:15:42.969098Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179
[2m2025-08-09T01:15:42.969104Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143
[2m2025-08-09T01:15:42.974252Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1659895a4/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:15:43 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede1659895a4/sample1_align2genome.bam
sample2 ->/tmp/Rtmph7B7OO/filede1659895a4/sample2_align2genome.bam
sample3 ->/tmp/Rtmph7B7OO/filede1659895a4/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Aug  8 21:16:10 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:16:33 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede1659895a4/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmph7B7OO/filede1659895a4/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmph7B7OO/filede1659895a4/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:16:59 2025 ----------
[2m2025-08-09T01:16:59.647382Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:16:59.648110Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1659895a4/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:16:59.648168Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:16:59.648187Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:16:59.648355Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:16:59.648379Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:16:59.651118Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:16:59.651568Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:16:59.651642Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116
[2m2025-08-09T01:16:59.651653Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96
[2m2025-08-09T01:16:59.651662Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-08-09T01:16:59.655227Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:16:59.725236Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:16:59.725874Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1659895a4/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:16:59.725921Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:16:59.725936Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:16:59.726112Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:16:59.726139Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:16:59.728185Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:16:59.728625Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:16:59.728707Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114
[2m2025-08-09T01:16:59.728720Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95
[2m2025-08-09T01:16:59.728729Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82
[2m2025-08-09T01:16:59.733535Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:16:59.791767Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:16:59.792296Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1659895a4/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:16:59.792346Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:16:59.792356Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:16:59.792464Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:16:59.792481Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:16:59.797320Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2025-08-09T01:16:59.797799Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:16:59.797868Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239
[2m2025-08-09T01:16:59.797880Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179
[2m2025-08-09T01:16:59.797889Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143
[2m2025-08-09T01:16:59.803641Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede161331cb48/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:17:00 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmph7B7OO/filede161331cb48/sample1_align2genome.bam
[M::mm_idx_gen::0.001*3.57] collected minimizers
[M::mm_idx_gen::0.002*2.64] sorted minimizers
[M::main::0.002*2.59] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.50] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.43] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.184*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161331cb48/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161331cb48/rps24.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample1.fq.gz
[M::main] Real time: 0.186 sec; CPU: 0.188 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/Rtmph7B7OO/filede161331cb48/sample2_align2genome.bam
[M::mm_idx_gen::0.001*4.24] collected minimizers
[M::mm_idx_gen::0.002*2.82] sorted minimizers
[M::main::0.002*2.77] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.63] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.52] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.185*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161331cb48/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161331cb48/rps24.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample2.fq.gz
[M::main] Real time: 0.186 sec; CPU: 0.190 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/Rtmph7B7OO/filede161331cb48/sample3_align2genome.bam
[M::mm_idx_gen::0.001*3.96] collected minimizers
[M::mm_idx_gen::0.002*2.80] sorted minimizers
[M::main::0.002*2.73] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.61] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.51] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.374*1.00] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161331cb48/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161331cb48/rps24.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample3.fq.gz
[M::main] Real time: 0.375 sec; CPU: 0.375 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Aug  8 21:17:01 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%Error in x$.self$finalize() : attempt to apply non-function
Error in x$.self$finalize() : attempt to apply non-function
In addition: Warning message:
call dbDisconnect() when finished working with a connection 

  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:17:23 2025 -------------------
Realigning sample sample1 -> /tmp/Rtmph7B7OO/filede161331cb48/sample1_realign2transcript.bam
[M::mm_idx_gen::0.001*4.44] collected minimizers
[M::mm_idx_gen::0.002*3.30] sorted minimizers
[M::main::0.002*3.21] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*3.11] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*3.03] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.080*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede161331cb48/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample1.fq.gz
[M::main] Real time: 0.080 sec; CPU: 0.083 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/Rtmph7B7OO/filede161331cb48/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*5.76] collected minimizers
[M::mm_idx_gen::0.001*4.40] sorted minimizers
[M::main::0.001*4.15] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.72] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.52] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.085*1.03] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede161331cb48/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample2.fq.gz
[M::main] Real time: 0.087 sec; CPU: 0.090 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/Rtmph7B7OO/filede161331cb48/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*5.77] collected minimizers
[M::mm_idx_gen::0.001*4.24] sorted minimizers
[M::main::0.001*4.02] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.84] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.58] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.151*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede161331cb48/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161331cb48/fastq/sample3.fq.gz
[M::main] Real time: 0.152 sec; CPU: 0.155 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:17:24 2025 ----------
21:17:24 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1650b40814/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:17:26 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede1650b40814/sample1_align2genome.bam
sample2 ->/tmp/Rtmph7B7OO/filede1650b40814/sample2_align2genome.bam
sample3 ->/tmp/Rtmph7B7OO/filede1650b40814/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Aug  8 21:17:53 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:18:16 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede1650b40814/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmph7B7OO/filede1650b40814/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmph7B7OO/filede1650b40814/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:18:43 2025 ----------
21:18:43 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/Rtmph7B7OO/filede161331cb48/sample3_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede161331cb48/sample2_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede161331cb48/sample1_realign2transcript.bam'] /tmp/Rtmph7B7OO/filede161331cb48/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
Inputs:  ['/tmp/Rtmph7B7OO/filede1650b40814/sample3_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede1650b40814/sample2_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede1650b40814/sample1_realign2transcript.bam'] /tmp/Rtmph7B7OO/filede1650b40814/transcript_assembly.fa.fai 5 0.4 0.4
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1645599820/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:18:46 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmph7B7OO/filede1645599820/sample1_align2genome.bam
[M::mm_idx_gen::0.001*4.46] collected minimizers
[M::mm_idx_gen::0.002*2.81] sorted minimizers
[M::main::0.002*2.71] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.58] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.48] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.200*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1645599820/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1645599820/rps24.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample1.fq.gz
[M::main] Real time: 0.202 sec; CPU: 0.204 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/Rtmph7B7OO/filede1645599820/sample2_align2genome.bam
[M::mm_idx_gen::0.001*3.95] collected minimizers
[M::mm_idx_gen::0.002*2.75] sorted minimizers
[M::main::0.002*2.67] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.58] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.51] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.228*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1645599820/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1645599820/rps24.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample2.fq.gz
[M::main] Real time: 0.229 sec; CPU: 0.231 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/Rtmph7B7OO/filede1645599820/sample3_align2genome.bam
[M::mm_idx_gen::0.001*4.37] collected minimizers
[M::mm_idx_gen::0.002*3.17] sorted minimizers
[M::main::0.002*3.10] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*3.00] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.90] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.424*1.00] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1645599820/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1645599820/rps24.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample3.fq.gz
[M::main] Real time: 0.425 sec; CPU: 0.426 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Aug  8 21:18:47 2025 -------------
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:18:48 2025 -------------------
Realigning sample sample1 -> /tmp/Rtmph7B7OO/filede1645599820/sample1_realign2transcript.bam
[M::mm_idx_gen::0.002*4.12] collected minimizers
[M::mm_idx_gen::0.002*3.35] sorted minimizers
[M::main::0.002*3.18] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.003*3.05] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.003*2.96] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.212*1.00] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1645599820/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample1.fq.gz
[M::main] Real time: 0.212 sec; CPU: 0.213 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/Rtmph7B7OO/filede1645599820/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*3.65] collected minimizers
[M::mm_idx_gen::0.002*2.86] sorted minimizers
[M::main::0.002*2.77] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*2.63] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*2.52] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.200*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1645599820/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample2.fq.gz
[M::main] Real time: 0.201 sec; CPU: 0.202 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/Rtmph7B7OO/filede1645599820/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*3.71] collected minimizers
[M::mm_idx_gen::0.002*3.00] sorted minimizers
[M::main::0.002*2.94] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*2.78] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*2.67] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.376*1.00] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1645599820/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1645599820/fastq/sample3.fq.gz
[M::main] Real time: 0.377 sec; CPU: 0.376 sec; Peak RSS: 0.006 GB
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Aug  8 21:18:49 2025 ----------
[2m2025-08-09T01:18:49.685886Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:18:49.688992Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1645599820/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:18:49.689046Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:18:49.689066Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:18:49.690343Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:18:49.690382Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:18:49.696538Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:18:49.698548Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:18:49.698722Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-08-09T01:18:49.698752Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-08-09T01:18:49.698762Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-08-09T01:18:49.704587Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:18:49.758347Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:18:49.758986Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1645599820/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:18:49.759018Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:18:49.759034Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:18:49.759196Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:18:49.759218Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:18:49.764076Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:18:49.764460Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:18:49.764533Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-08-09T01:18:49.764548Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-08-09T01:18:49.764558Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-08-09T01:18:49.770708Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:18:49.835739Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:18:49.836716Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede1645599820/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:18:49.836753Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:18:49.836765Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:18:49.836896Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:18:49.836911Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:18:49.844611Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:18:49.845972Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:18:49.846351Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-08-09T01:18:49.846382Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-08-09T01:18:49.846417Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-08-09T01:18:49.852381Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede16405f701e/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:18:50 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede16405f701e/sample1_align2genome.bam
sample2 ->/tmp/Rtmph7B7OO/filede16405f701e/sample2_align2genome.bam
sample3 ->/tmp/Rtmph7B7OO/filede16405f701e/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Aug  8 21:19:16 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:19:17 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede16405f701e/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmph7B7OO/filede16405f701e/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmph7B7OO/filede16405f701e/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:19:42 2025 ----------
[2m2025-08-09T01:19:42.963587Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:19:42.966591Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede16405f701e/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:19:42.966659Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:19:42.966699Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:19:42.968040Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:19:42.968102Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:19:42.974681Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:19:42.976745Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:19:42.976933Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-08-09T01:19:42.976951Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-08-09T01:19:42.976960Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-08-09T01:19:42.981149Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:19:43.034605Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:19:43.035353Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede16405f701e/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:19:43.035394Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:19:43.035406Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:19:43.035647Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:19:43.035682Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:19:43.039276Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:19:43.039732Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:19:43.039814Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-08-09T01:19:43.039824Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-08-09T01:19:43.039831Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-08-09T01:19:43.044100Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-08-09T01:19:43.100180Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:19:43.100927Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede16405f701e/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:19:43.100968Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:19:43.100981Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:19:43.101134Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:19:43.101156Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:19:43.108884Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-08-09T01:19:43.109388Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-08-09T01:19:43.109473Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-08-09T01:19:43.109484Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-08-09T01:19:43.109490Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-08-09T01:19:43.114455Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede165bd867b3/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:19:44 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample1_align2genome.bam
[M::mm_idx_gen::0.001*3.33] collected minimizers
[M::mm_idx_gen::0.003*2.30] sorted minimizers
[M::main::0.003*2.26] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*2.19] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.12] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.207*1.00] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165bd867b3/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165bd867b3/rps24.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample1.fq.gz
[M::main] Real time: 0.208 sec; CPU: 0.208 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample2_align2genome.bam
[M::mm_idx_gen::0.001*3.76] collected minimizers
[M::mm_idx_gen::0.002*2.60] sorted minimizers
[M::main::0.002*2.57] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.48] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.35] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.209*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165bd867b3/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165bd867b3/rps24.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample2.fq.gz
[M::main] Real time: 0.210 sec; CPU: 0.212 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample3_align2genome.bam
[M::mm_idx_gen::0.001*5.07] collected minimizers
[M::mm_idx_gen::0.002*2.88] sorted minimizers
[M::main::0.002*2.81] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.68] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.57] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.416*1.00] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede165bd867b3/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede165bd867b3/rps24.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample3.fq.gz
[M::main] Real time: 0.418 sec; CPU: 0.419 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Aug  8 21:19:45 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:19:46 2025 -------------------
Realigning sample sample1 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample1_realign2transcript.bam
[M::mm_idx_gen::0.001*4.39] collected minimizers
[M::mm_idx_gen::0.002*3.37] sorted minimizers
[M::main::0.002*3.25] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*3.13] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*3.02] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.112*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165bd867b3/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample1.fq.gz
[M::main] Real time: 0.112 sec; CPU: 0.116 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*3.80] collected minimizers
[M::mm_idx_gen::0.002*2.89] sorted minimizers
[M::main::0.002*2.82] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*2.72] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*2.63] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.103*1.03] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165bd867b3/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample2.fq.gz
[M::main] Real time: 0.103 sec; CPU: 0.106 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/Rtmph7B7OO/filede165bd867b3/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*5.00] collected minimizers
[M::mm_idx_gen::0.002*3.68] sorted minimizers
[M::main::0.002*3.56] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*3.37] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*3.25] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.196*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede165bd867b3/transcript_assembly.fa /tmp/Rtmph7B7OO/filede165bd867b3/fastq/sample3.fq.gz
[M::main] Real time: 0.197 sec; CPU: 0.200 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:19:47 2025 ----------
21:19:47 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede167c2a4a47/config_file_56854.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Aug  8 21:19:49 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample1_align2genome.bam
sample2 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample2_align2genome.bam
sample3 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Aug  8 21:20:15 2025 -------------
Inputs:  ['/tmp/Rtmph7B7OO/filede165bd867b3/sample3_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede165bd867b3/sample2_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede165bd867b3/sample1_realign2transcript.bam'] /tmp/Rtmph7B7OO/filede165bd867b3/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:20:16 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample1_realign2transcript.bam
sample2 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample2_realign2transcript.bam
sample3 ->/tmp/Rtmph7B7OO/filede167c2a4a47/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:20:41 2025 ----------
21:20:41 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede16c6bdec5/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:20:42 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16c6bdec5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:20:42 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede16c6bdec5/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.02] collected minimizers
[M::mm_idx_gen::0.002*5.21] sorted minimizers
[M::main::0.003*5.07] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*4.79] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*4.55] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.117*6.98] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /tmp/Rtmph7B7OO/filede16c6bdec5/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede16c6bdec5/rps24.fa /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads.fastq.gz
[M::main] Real time: 0.119 sec; CPU: 0.821 sec; Peak RSS: 0.022 GB
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:20:43 2025 ----------------
21:20:43 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede16c6bdec5/align2genome.bam'
Inputs:  ['/tmp/Rtmph7B7OO/filede167c2a4a47/sample3_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede167c2a4a47/sample2_realign2transcript.bam', '/tmp/Rtmph7B7OO/filede167c2a4a47/sample1_realign2transcript.bam'] /tmp/Rtmph7B7OO/filede167c2a4a47/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.28s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.29s/gene_group]
2025-08-08 21:20:46.735 R[56854:416663890] XType: com.apple.fonts is not accessible.
2025-08-08 21:20:46.735 R[56854:416663890] XType: XTFontStaticRegistry is enabled.
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 25882.07Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:20:47 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:20:59 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede16c6bdec5/realign2transcript.bam
[M::mm_idx_gen::0.001*4.59] collected minimizers
[M::mm_idx_gen::0.002*5.56] sorted minimizers
[M::main::0.002*5.40] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*5.25] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*5.11] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.072*5.04] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 8 --seed 2022 -y /tmp/Rtmph7B7OO/filede16c6bdec5/transcript_assembly.fa /tmp/Rtmph7B7OO/filede16c6bdec5/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.073 sec; CPU: 0.364 sec; Peak RSS: 0.011 GB
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Aug  8 21:20:59 2025 ----------
[2m2025-08-09T01:20:59.884051Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:20:59.887050Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede16c6bdec5/realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:20:59.887117Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:20:59.887130Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:20:59.888216Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:20:59.888269Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:20:59.901590Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede164fa4bb30/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:21:01 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede164fa4bb30/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:21:02 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede164fa4bb30/matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede164fa4bb30/align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:21:27 2025 ----------------
21:21:27 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede164fa4bb30/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.23s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.23s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 28067.49Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:21:28 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:21:41 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede164fa4bb30/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede164fa4bb30/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede164fa4bb30/matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede164fa4bb30/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:22:06 2025 ----------
[2m2025-08-09T01:22:06.391302Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:22:06.392026Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede164fa4bb30/realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:22:06.392064Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:22:06.392077Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:22:06.392234Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:22:06.392266Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:22:06.400247Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede16615492fc/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:22:08 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16615492fc/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:22:09 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede16615492fc/matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede16615492fc/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.80] collected minimizers
[M::mm_idx_gen::0.002*5.78] sorted minimizers
[M::main::0.002*5.59] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*5.30] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*5.05] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.121*6.63] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /tmp/Rtmph7B7OO/filede16615492fc/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede16615492fc/rps24.fa /tmp/Rtmph7B7OO/filede16615492fc/matched_reads.fastq.gz
[M::main] Real time: 0.123 sec; CPU: 0.807 sec; Peak RSS: 0.022 GB
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:22:09 2025 ----------------
21:22:09 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede16615492fc/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.30s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.31s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26531.12Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:22:11 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:22:23 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16615492fc/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16615492fc/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede16615492fc/matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede16615492fc/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*5.84] collected minimizers
[M::mm_idx_gen::0.002*6.28] sorted minimizers
[M::main::0.002*6.00] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*5.66] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*5.42] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.065*4.85] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 8 --seed 2022 /tmp/Rtmph7B7OO/filede16615492fc/transcript_assembly.fa /tmp/Rtmph7B7OO/filede16615492fc/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.066 sec; CPU: 0.317 sec; Peak RSS: 0.010 GB
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:22:24 2025 ----------
21:22:24 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1646861cad/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:22:25 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1646861cad/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:22:25 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede1646861cad/matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede1646861cad/align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:22:49 2025 ----------------
21:22:49 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede1646861cad/align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.27s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.28s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 21390.56Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:22:51 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:23:04 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1646861cad/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1646861cad/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede1646861cad/matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede1646861cad/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:23:30 2025 ----------
21:23:30 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede167706d05e/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:23:31 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede167706d05e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:23:32 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede167706d05e/matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede167706d05e/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.58] collected minimizers
[M::mm_idx_gen::0.002*5.46] sorted minimizers
[M::main::0.002*5.19] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*4.95] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*4.75] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.106*6.98] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /tmp/Rtmph7B7OO/filede167706d05e/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede167706d05e/rps24.fa /tmp/Rtmph7B7OO/filede167706d05e/matched_reads.fastq.gz
[M::main] Real time: 0.107 sec; CPU: 0.742 sec; Peak RSS: 0.022 GB
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:23:32 2025 ----------------
21:23:32 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede167706d05e/align2genome.bam'
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.17s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.18s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 27579.15Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:23:34 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:23:35 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede167706d05e/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede167706d05e/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede167706d05e/matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede167706d05e/realign2transcript.bam
[M::mm_idx_gen::0.001*3.49] collected minimizers
[M::mm_idx_gen::0.002*4.86] sorted minimizers
[M::main::0.003*4.57] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.003*4.38] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.003*4.21] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.114*6.21] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 8 --seed 2022 -y /tmp/Rtmph7B7OO/filede167706d05e/transcript_assembly.fa /tmp/Rtmph7B7OO/filede167706d05e/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.115 sec; CPU: 0.711 sec; Peak RSS: 0.012 GB
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Aug  8 21:23:35 2025 ----------
[2m2025-08-09T01:23:35.758159Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:23:35.759173Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede167706d05e/realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:23:35.759237Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:23:35.759257Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:23:35.759448Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:23:35.759488Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:23:35.770661Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede167f604e78/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:23:37 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede167f604e78/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:23:38 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede167f604e78/matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede167f604e78/align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:24:02 2025 ----------------
21:24:02 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede167f604e78/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.19s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.20s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 24495.38Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:24:04 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:24:05 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede167f604e78/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede167f604e78/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede167f604e78/matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede167f604e78/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:24:29 2025 ----------
[2m2025-08-09T01:24:29.973346Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:24:29.974490Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede167f604e78/realign2transcript.bam, contains 10 reference sequences.
[2m2025-08-09T01:24:29.974545Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:24:29.974561Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:24:29.974715Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:24:29.974741Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-08-09T01:24:29.987886Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede16ee98903/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:24:32 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16ee98903/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:24:33 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede16ee98903/matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede16ee98903/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.21] collected minimizers
[M::mm_idx_gen::0.002*5.17] sorted minimizers
[M::main::0.002*5.00] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*4.78] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*4.58] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.120*7.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /tmp/Rtmph7B7OO/filede16ee98903/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede16ee98903/rps24.fa /tmp/Rtmph7B7OO/filede16ee98903/matched_reads.fastq.gz
[M::main] Real time: 0.121 sec; CPU: 0.844 sec; Peak RSS: 0.023 GB
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:24:33 2025 ----------------
21:24:33 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede16ee98903/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.30s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.30s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 23259.25Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:24:35 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:24:36 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16ee98903/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16ee98903/matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede16ee98903/matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede16ee98903/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.48] collected minimizers
[M::mm_idx_gen::0.002*5.31] sorted minimizers
[M::main::0.002*5.14] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.003*4.87] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.003*4.69] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.067*6.10] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 8 --seed 2022 /tmp/Rtmph7B7OO/filede16ee98903/transcript_assembly.fa /tmp/Rtmph7B7OO/filede16ee98903/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.068 sec; CPU: 0.409 sec; Peak RSS: 0.011 GB
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:24:36 2025 ----------
21:24:36 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
	Counter({'counted_reads': 358})
Error in x$.self$finalize() : attempt to apply non-function
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede161f756af/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:24:37 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede161f756af/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:24:38 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede161f756af/matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede161f756af/align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:25:04 2025 ----------------
21:25:04 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede161f756af/align2genome.bam'
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.27s/gene_group]
Processed: 100%|██████████| 1/1 [00:01<00:00,  1.28s/gene_group]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26154.77Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:25:05 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:25:07 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede161f756af/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede161f756af/matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede161f756af/matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede161f756af/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:25:31 2025 ----------
21:25:31 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede161ace7125/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:25:33 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede161ace7125/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede161ace7125/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede161ace7125/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede161ace7125/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:25:35 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.76] collected minimizers
[M::mm_idx_gen::0.002*2.78] sorted minimizers
[M::main::0.002*2.72] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.62] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.53] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.666*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161ace7125/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161ace7125/rps24.fa /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.667 sec; CPU: 0.667 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*5.01] collected minimizers
[M::mm_idx_gen::0.002*3.13] sorted minimizers
[M::main::0.002*2.99] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.86] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.73] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.179*1.02] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161ace7125/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161ace7125/rps24.fa /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.180 sec; CPU: 0.184 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.35] collected minimizers
[M::mm_idx_gen::0.002*2.61] sorted minimizers
[M::main::0.002*2.54] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.43] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.33] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.161*1.01] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161ace7125/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161ace7125/rps24.fa /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.163 sec; CPU: 0.165 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.48] collected minimizers
[M::mm_idx_gen::0.002*2.41] sorted minimizers
[M::main::0.002*2.37] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.29] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.23] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.340*1.00] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede161ace7125/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede161ace7125/rps24.fa /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.342 sec; CPU: 0.342 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:25:36 2025 ----------------
21:25:36 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede161ace7125/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede161ace7125/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede161ace7125/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede161ace7125/sample3_align2genome.bam'
	Counter({'counted_reads': 358})
parsing /tmp/Rtmph7B7OO/filede161ace7125/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.51gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26964.90Read/s]
parsing /tmp/Rtmph7B7OO/filede161ace7125/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 39.47gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 128980.90Read/s]
parsing /tmp/Rtmph7B7OO/filede161ace7125/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 44.00gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 107790.58Read/s]
parsing /tmp/Rtmph7B7OO/filede161ace7125/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 36.38gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 56166.99Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:25:38 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:26:07 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede161ace7125/fastq, /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede161ace7125/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sampleA_realign2transcript.bam
[M::mm_idx_gen::0.001*4.25] collected minimizers
[M::mm_idx_gen::0.001*3.23] sorted minimizers
[M::main::0.001*3.11] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*2.99] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.87] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.288*1.00] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede161ace7125/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161ace7125/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.289 sec; CPU: 0.290 sec; Peak RSS: 0.006 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample1_realign2transcript.bam
[M::mm_idx_gen::0.001*5.55] collected minimizers
[M::mm_idx_gen::0.001*4.24] sorted minimizers
[M::main::0.001*4.06] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.93] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.81] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.077*1.05] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede161ace7125/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161ace7125/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.077 sec; CPU: 0.081 sec; Peak RSS: 0.004 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*5.23] collected minimizers
[M::mm_idx_gen::0.001*4.03] sorted minimizers
[M::main::0.001*3.89] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.75] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.61] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.072*1.04] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede161ace7125/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161ace7125/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.073 sec; CPU: 0.075 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede161ace7125/sample3_realign2transcript.bam
[M::mm_idx_gen::0.002*3.63] collected minimizers
[M::mm_idx_gen::0.002*3.07] sorted minimizers
[M::main::0.002*3.03] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*2.98] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.93] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.139*1.02] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede161ace7125/transcript_assembly.fa /tmp/Rtmph7B7OO/filede161ace7125/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.139 sec; CPU: 0.142 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Aug  8 21:26:08 2025 ----------
[2m2025-08-09T01:26:08.386332Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:26:08.387204Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede161ace7125/sampleA_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:26:08.387254Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:26:08.387268Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:26:08.387415Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:26:08.387434Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:26:08.396634Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:26:10.123582Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:26:10.124412Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede161ace7125/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:26:10.124468Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:26:10.124489Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:26:10.124650Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:26:10.124672Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:26:11.911306Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:26:11.911947Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede161ace7125/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:26:11.911989Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:26:11.912002Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:26:11.912127Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:26:11.912180Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:26:13.702308Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:26:13.703019Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede161ace7125/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:26:13.703077Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:26:13.703123Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:26:13.703437Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:26:13.703485Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede162eaefbb6/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:26:15 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede162eaefbb6/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede162eaefbb6/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede162eaefbb6/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede162eaefbb6/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:26:17 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_align2genome.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample1_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample1_align2genome.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample2_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample2_align2genome.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample3_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:26:43 2025 ----------------
21:26:43 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede162eaefbb6/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede162eaefbb6/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede162eaefbb6/sample3_align2genome.bam'
parsing /tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 15.13gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 25944.90Read/s]
parsing /tmp/Rtmph7B7OO/filede162eaefbb6/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 37.48gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 131273.83Read/s]
parsing /tmp/Rtmph7B7OO/filede162eaefbb6/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 39.72gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 103352.78Read/s]
parsing /tmp/Rtmph7B7OO/filede162eaefbb6/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.42gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 49864.75Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:26:44 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:27:13 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede162eaefbb6/fastq, /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede162eaefbb6/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_realign2transcript.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample1_realign2transcript.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample2_realign2transcript.bam
/tmp/Rtmph7B7OO/filede162eaefbb6/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede162eaefbb6/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:27:39 2025 ----------
[2m2025-08-09T01:27:39.147206Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:27:39.147841Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede162eaefbb6/sampleA_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:27:39.147882Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:27:39.147896Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:27:39.148002Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:27:39.148022Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-08-09T01:27:39.156054Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:27:41.137556Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:27:41.138222Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede162eaefbb6/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:27:41.138270Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:27:41.138293Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:27:41.138482Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:27:41.138508Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Error in x$.self$finalize() : attempt to apply non-function
Error in x$.self$finalize() : attempt to apply non-function
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:27:43.012664Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:27:43.013896Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede162eaefbb6/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:27:43.013978Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:27:43.014025Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:27:43.014436Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:27:43.014496Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:27:44.845880Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:27:44.846495Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede162eaefbb6/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-08-09T01:27:44.846544Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:27:44.846563Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:27:44.846742Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:27:44.846779Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede164a965e14/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:27:47 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede164a965e14/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede164a965e14/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede164a965e14/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede164a965e14/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:27:48 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.54] collected minimizers
[M::mm_idx_gen::0.002*2.98] sorted minimizers
[M::main::0.002*2.90] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.77] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.64] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.769*0.99] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede164a965e14/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede164a965e14/rps24.fa /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.771 sec; CPU: 0.764 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.68] collected minimizers
[M::mm_idx_gen::0.002*2.70] sorted minimizers
[M::main::0.002*2.63] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.51] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.40] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.185*1.01] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede164a965e14/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede164a965e14/rps24.fa /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.186 sec; CPU: 0.188 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*5.05] collected minimizers
[M::mm_idx_gen::0.002*2.91] sorted minimizers
[M::main::0.002*2.84] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.72] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.63] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.224*0.98] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede164a965e14/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede164a965e14/rps24.fa /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.226 sec; CPU: 0.221 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.002*4.34] collected minimizers
[M::mm_idx_gen::0.003*2.92] sorted minimizers
[M::main::0.003*2.73] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*2.63] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.54] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.358*1.01] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede164a965e14/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede164a965e14/rps24.fa /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.360 sec; CPU: 0.362 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:27:50 2025 ----------------
21:27:50 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede164a965e14/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede164a965e14/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede164a965e14/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede164a965e14/sample3_align2genome.bam'
parsing /tmp/Rtmph7B7OO/filede164a965e14/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  6.25gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  6.24gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26176.84Read/s]
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 33.15gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 137946.93Read/s]
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 35.32gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 114668.65Read/s]
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 23.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 52616.38Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:27:51 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:28:20 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede164a965e14/fastq, /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede164a965e14/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.73] collected minimizers
[M::mm_idx_gen::0.001*3.44] sorted minimizers
[M::main::0.001*3.28] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.11] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.96] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.265*1.00] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede164a965e14/transcript_assembly.fa /tmp/Rtmph7B7OO/filede164a965e14/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.266 sec; CPU: 0.267 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.47] collected minimizers
[M::mm_idx_gen::0.001*3.37] sorted minimizers
[M::main::0.001*3.23] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.09] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.95] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.068*1.03] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede164a965e14/transcript_assembly.fa /tmp/Rtmph7B7OO/filede164a965e14/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.069 sec; CPU: 0.071 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.79] collected minimizers
[M::mm_idx_gen::0.001*3.42] sorted minimizers
[M::main::0.002*3.18] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*3.04] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*2.92] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.068*1.04] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede164a965e14/transcript_assembly.fa /tmp/Rtmph7B7OO/filede164a965e14/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.069 sec; CPU: 0.071 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede164a965e14/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.93] collected minimizers
[M::mm_idx_gen::0.001*4.00] sorted minimizers
[M::main::0.001*3.92] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*3.81] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.68] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.138*1.02] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede164a965e14/transcript_assembly.fa /tmp/Rtmph7B7OO/filede164a965e14/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.139 sec; CPU: 0.142 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:28:21 2025 ----------
21:28:21 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample3_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede164a965e14/sample3_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede164a965e14/sampleA_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede164a965e14/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede164a965e14/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample2_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede164a965e14/sample2_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample1_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede164a965e14/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede164a965e14/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1671c5a476/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:28:24 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1671c5a476/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1671c5a476/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1671c5a476/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1671c5a476/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:28:25 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_align2genome.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample1_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample1_align2genome.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample2_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample2_align2genome.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample3_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:28:51 2025 ----------------
21:28:51 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede1671c5a476/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede1671c5a476/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede1671c5a476/sample3_align2genome.bam'
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 16.06gene_group/s]
/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/python/count_gene.py:704: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26730.29Read/s]
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 41.24gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 123746.22Read/s]
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 46.79gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 96216.40Read/s]
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 22.53gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 55196.05Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:28:52 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:29:21 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1671c5a476/fastq, /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1671c5a476/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1671c5a476/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1671c5a476/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_realign2transcript.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample1_realign2transcript.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample2_realign2transcript.bam
/tmp/Rtmph7B7OO/filede1671c5a476/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede1671c5a476/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:29:46 2025 ----------
21:29:46 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample3_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1671c5a476/sample3_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sampleA_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1671c5a476/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample2_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1671c5a476/sample2_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample1_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1671c5a476/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1671c5a476/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede163813d7d4/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:29:51 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede163813d7d4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede163813d7d4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede163813d7d4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede163813d7d4/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:29:52 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.17] collected minimizers
[M::mm_idx_gen::0.002*2.49] sorted minimizers
[M::main::0.002*2.45] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.38] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.30] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.654*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede163813d7d4/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede163813d7d4/rps24.fa /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.655 sec; CPU: 0.655 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.51] collected minimizers
[M::mm_idx_gen::0.002*2.72] sorted minimizers
[M::main::0.002*2.62] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.50] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.38] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.176*1.01] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede163813d7d4/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede163813d7d4/rps24.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.177 sec; CPU: 0.179 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.23] collected minimizers
[M::mm_idx_gen::0.002*2.46] sorted minimizers
[M::main::0.002*2.41] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.31] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.21] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.175*1.01] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede163813d7d4/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede163813d7d4/rps24.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.177 sec; CPU: 0.179 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.45] collected minimizers
[M::mm_idx_gen::0.002*2.32] sorted minimizers
[M::main::0.002*2.29] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*2.14] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.04] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.348*1.00] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede163813d7d4/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede163813d7d4/rps24.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.350 sec; CPU: 0.351 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:29:53 2025 ----------------
21:29:53 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede163813d7d4/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede163813d7d4/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede163813d7d4/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede163813d7d4/sample3_align2genome.bam'
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
parsing /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.26gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 26779.31Read/s]
parsing /tmp/Rtmph7B7OO/filede163813d7d4/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 42.01gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 130173.80Read/s]
parsing /tmp/Rtmph7B7OO/filede163813d7d4/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 42.77gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 101932.15Read/s]
parsing /tmp/Rtmph7B7OO/filede163813d7d4/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.33gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 59651.73Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:29:55 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:29:55 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede163813d7d4/fastq, /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_realign2transcript.bam
[M::mm_idx_gen::0.001*3.00] collected minimizers
[M::mm_idx_gen::0.002*2.43] sorted minimizers
[M::main::0.002*2.36] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.29] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.25] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.768*1.00] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede163813d7d4/transcript_assembly.fa /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.769 sec; CPU: 0.769 sec; Peak RSS: 0.008 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample1_realign2transcript.bam
[M::mm_idx_gen::0.002*3.11] collected minimizers
[M::mm_idx_gen::0.002*2.56] sorted minimizers
[M::main::0.002*2.52] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.44] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.38] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.209*1.01] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede163813d7d4/transcript_assembly.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.210 sec; CPU: 0.212 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*3.36] collected minimizers
[M::mm_idx_gen::0.002*2.74] sorted minimizers
[M::main::0.002*2.60] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.51] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.42] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.220*1.01] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede163813d7d4/transcript_assembly.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.221 sec; CPU: 0.224 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede163813d7d4/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*3.54] collected minimizers
[M::mm_idx_gen::0.002*2.90] sorted minimizers
[M::main::0.002*2.84] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.76] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.69] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.364*1.01] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /tmp/Rtmph7B7OO/filede163813d7d4/transcript_assembly.fa /tmp/Rtmph7B7OO/filede163813d7d4/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.365 sec; CPU: 0.367 sec; Peak RSS: 0.006 GB
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Aug  8 21:29:57 2025 ----------
[2m2025-08-09T01:29:58.018725Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:29:58.019425Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede163813d7d4/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:29:58.019472Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:29:58.019484Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:29:58.019846Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:29:58.019895Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-08-09T01:29:58.034445Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:29:59.893869Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:29:59.894713Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede163813d7d4/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:29:59.894757Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:29:59.894772Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:29:59.894967Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:29:59.894996Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:30:01.780943Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:30:01.781718Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede163813d7d4/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:30:01.781753Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:30:01.781765Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:30:01.781914Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:30:01.781931Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:30:03.652009Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:30:03.652894Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede163813d7d4/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:30:03.652929Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:30:03.652938Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:30:03.653177Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:30:03.653213Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede166d239eea/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:30:05 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede166d239eea/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede166d239eea/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede166d239eea/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede166d239eea/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:30:06 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede166d239eea/sampleA_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sampleA_align2genome.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample1_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample1_align2genome.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample2_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample2_align2genome.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample3_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:30:39 2025 ----------------
21:30:39 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede166d239eea/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede166d239eea/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede166d239eea/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede166d239eea/sample3_align2genome.bam'
parsing /tmp/Rtmph7B7OO/filede166d239eea/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 14.29gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 22519.08Read/s]
parsing /tmp/Rtmph7B7OO/filede166d239eea/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  5.76gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  5.75gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 124476.31Read/s]
parsing /tmp/Rtmph7B7OO/filede166d239eea/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 33.16gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 106138.69Read/s]
parsing /tmp/Rtmph7B7OO/filede166d239eea/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 21.02gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 47608.23Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:30:41 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:30:43 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede166d239eea/fastq, /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede166d239eea/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede166d239eea/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede166d239eea/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede166d239eea/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede166d239eea/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sampleA_realign2transcript.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample1_realign2transcript.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample2_realign2transcript.bam
/tmp/Rtmph7B7OO/filede166d239eea/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede166d239eea/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:31:12 2025 ----------
[2m2025-08-09T01:31:12.679584Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:31:12.680374Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede166d239eea/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:31:12.680423Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:31:12.680443Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:31:12.680677Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:31:12.680712Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-08-09T01:31:12.695255Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:31:15.055043Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:31:15.055806Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede166d239eea/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:31:15.055858Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:31:15.055877Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:31:15.056062Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:31:15.056093Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:31:17.025703Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:31:17.026514Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede166d239eea/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:31:17.026568Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:31:17.026587Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:31:17.026878Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:31:17.026932Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-08-09T01:31:19.119872Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-08-09T01:31:19.120667Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/Rtmph7B7OO/filede166d239eea/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-08-09T01:31:19.120724Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-08-09T01:31:19.120744Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-08-09T01:31:19.120931Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-08-09T01:31:19.120962Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede1616089f4f/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:31:22 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1616089f4f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1616089f4f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1616089f4f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede1616089f4f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:31:23 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.95] collected minimizers
[M::mm_idx_gen::0.002*2.56] sorted minimizers
[M::main::0.003*2.52] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.003*2.42] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.32] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.725*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1616089f4f/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1616089f4f/rps24.fa /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.726 sec; CPU: 0.726 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.47] collected minimizers
[M::mm_idx_gen::0.002*2.57] sorted minimizers
[M::main::0.002*2.49] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.36] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.25] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.183*1.01] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1616089f4f/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1616089f4f/rps24.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.184 sec; CPU: 0.187 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.87] collected minimizers
[M::mm_idx_gen::0.002*2.63] sorted minimizers
[M::main::0.002*2.56] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.42] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.003*2.30] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.166*1.02] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1616089f4f/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1616089f4f/rps24.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.169 sec; CPU: 0.172 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.98] collected minimizers
[M::mm_idx_gen::0.002*2.93] sorted minimizers
[M::main::0.002*2.87] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*2.75] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.63] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.344*1.00] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /tmp/Rtmph7B7OO/filede1616089f4f/reference.bed --junc-bonus 1 /tmp/Rtmph7B7OO/filede1616089f4f/rps24.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.346 sec; CPU: 0.345 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Aug  8 21:31:25 2025 ----------------
21:31:25 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede1616089f4f/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede1616089f4f/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede1616089f4f/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede1616089f4f/sample3_align2genome.bam'
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.25gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 25615.82Read/s]
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 39.88gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 132570.04Read/s]
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 38.62gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 107361.26Read/s]
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 31.63gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 54691.38Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:31:26 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:31:27 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1616089f4f/fastq, /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*3.86] collected minimizers
[M::mm_idx_gen::0.002*3.02] sorted minimizers
[M::main::0.002*2.94] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.80] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.68] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.392*1.00] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1616089f4f/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.393 sec; CPU: 0.393 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.002*3.18] collected minimizers
[M::mm_idx_gen::0.002*2.77] sorted minimizers
[M::main::0.002*2.69] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*2.62] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*2.56] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.112*1.03] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1616089f4f/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.112 sec; CPU: 0.116 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.08] collected minimizers
[M::mm_idx_gen::0.002*3.29] sorted minimizers
[M::main::0.002*3.20] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*3.10] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*3.00] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.100*1.03] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1616089f4f/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.101 sec; CPU: 0.104 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads_dedup.fastq.gz -> /tmp/Rtmph7B7OO/filede1616089f4f/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.49] collected minimizers
[M::mm_idx_gen::0.001*3.70] sorted minimizers
[M::main::0.002*3.63] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.002*3.51] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.002*3.38] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.181*1.02] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /tmp/Rtmph7B7OO/filede1616089f4f/transcript_assembly.fa /tmp/Rtmph7B7OO/filede1616089f4f/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.182 sec; CPU: 0.185 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Aug  8 21:31:28 2025 ----------
21:31:28 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample3_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1616089f4f/sample3_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1616089f4f/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample2_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1616089f4f/sample2_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample1_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede1616089f4f/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede1616089f4f/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/Rtmph7B7OO/filede16712f269e/config_file_56854.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Aug  8 21:31:32 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16712f269e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16712f269e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16712f269e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/Rtmph7B7OO/filede16712f269e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Fri Aug  8 21:31:33 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/Rtmph7B7OO/filede16712f269e/sampleA_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sampleA_align2genome.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample1_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample1_align2genome.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample2_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample2_align2genome.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample3_matched_reads.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Aug  8 21:32:08 2025 ----------------
21:32:08 Fri Aug 08 2025 quantify genes 
Using BAM(s): '/tmp/Rtmph7B7OO/filede16712f269e/sampleA_align2genome.bam',
'/tmp/Rtmph7B7OO/filede16712f269e/sample1_align2genome.bam',
'/tmp/Rtmph7B7OO/filede16712f269e/sample2_align2genome.bam', and
'/tmp/Rtmph7B7OO/filede16712f269e/sample3_align2genome.bam'
	Counter({'counted_reads': 175, 'not_enough_coverage': 1})
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 91})
parsing /tmp/Rtmph7B7OO/filede16712f269e/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 12.05gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 23876.80Read/s]
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 30.92gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 123127.22Read/s]
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 31.36gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 100083.61Read/s]
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 26.11gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 50405.28Read/s]
-- Running step: isoform_identification @ Fri Aug  8 21:32:09 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Fri Aug  8 21:32:10 2025 -------------------
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16712f269e/fastq, /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample1.fq.gz, /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample2.fq.gz, /tmp/Rtmph7B7OO/filede16712f269e/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16712f269e/sampleA_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample1_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample2_matched_reads.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/Rtmph7B7OO/filede16712f269e/sampleA_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample1_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample2_matched_reads_dedup.fastq.gz, /tmp/Rtmph7B7OO/filede16712f269e/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/Rtmph7B7OO/filede16712f269e/sampleA_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sampleA_realign2transcript.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample1_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample1_realign2transcript.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample2_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample2_realign2transcript.bam
/tmp/Rtmph7B7OO/filede16712f269e/sample3_matched_reads_dedup.fastq.gz ->/tmp/Rtmph7B7OO/filede16712f269e/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Aug  8 21:32:47 2025 ----------
21:32:47 Fri Aug 08 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample3_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede16712f269e/sample3_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede16712f269e/sampleA_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede16712f269e/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede16712f269e/sampleA_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample2_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede16712f269e/sample2_realign2transcript.bamdone
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample1_realign2transcript.bam...
parsing /tmp/Rtmph7B7OO/filede16712f269e/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/Rtmph7B7OO/filede16712f269e/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
	Counter({'counted_reads': 175, 'not_enough_coverage': 1})
	Counter({'counted_reads': 357, 'not_enough_coverage': 1})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 91})
[ FAIL 0 | WARN 235 | SKIP 0 | PASS 37 ]

[ FAIL 0 | WARN 235 | SKIP 0 | PASS 37 ]
> 
> proc.time()
    user   system  elapsed 
 965.520   76.795 1089.875 
/Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
  warnings.warn('resource_tracker: There appear to be %d '

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

name	user	system	elapsed
BulkPipeline	5.497	0.721	6.760
MultiSampleSCPipeline	18.523	2.165	22.023
SingleCellPipeline	7.422	0.937	6.854
add_gene_counts	0.426	0.017	0.444
annotation_to_fasta	0.826	0.017	0.853
blaze	8.776	1.379	10.955
bulk_long_pipeline	5.121	1.012	5.027
combine_sce	2.639	0.339	3.016
config-set	0.307	0.157	0.503
config	0.302	0.166	0.516
controllers-set	0.498	0.069	0.629
controllers	0.438	0.169	0.721
convolution_filter	0.001	0.000	0.001
create_config	0.007	0.001	0.009
create_sce_from_dir	6.821	1.254	6.755
create_se_from_dir	4.198	0.765	5.437
cutadapt	0.168	0.064	0.262
example_pipeline	0.453	0.049	0.560
experiment	3.488	0.469	4.341
filter_annotation	0.749	0.014	0.777
filter_coverage	1.926	0.319	2.396
find_barcode	1.093	0.225	1.377
find_bin	0.006	0.009	0.036
find_variants	24.848	0.573	25.032
get_coverage	1.921	0.245	2.303
index_genome	0.301	0.161	0.552
mutation_positions	1.610	0.040	1.669
plot_coverage	3.367	0.322	3.863
plot_demultiplex	2.497	0.461	3.115
plot_demultiplex_raw	1.394	0.095	1.520
plot_isoform_heatmap	9.369	0.537	10.143
plot_isoform_reduced_dim	26.918	0.412	27.597
plot_isoforms	3.944	0.036	4.012
resume_FLAMES	3.442	0.404	4.085
run_FLAMES	3.390	0.420	4.098
run_step	1.330	0.254	1.710
sc_DTU_analysis	11.915	1.276	11.875
sc_impute_transcript	0.689	0.012	0.712
sc_long_multisample_pipeline	20.377	2.876	19.949
sc_long_pipeline	6.968	0.885	6.413
sc_mutations	3.710	0.434	3.576
show-FLAMESPipeline	0.454	0.041	0.532
steps-set	0.624	0.044	0.701
steps	0.214	0.041	0.301
weight_transcripts	0.026	0.016	0.043