Changqing Wang
| Snapshot Date: 2025-06-18 13:25 -0400 (Wed, 18 Jun 2025) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: devel |
| git_last_commit: 864717a |
| git_last_commit_date: 2025-06-17 22:10:31 -0400 (Tue, 17 Jun 2025) |
| Back to Multiple platform build/check report for BioC 3.22: simplified long |
|
This page was generated on 2025-06-19 12:04 -0400 (Thu, 19 Jun 2025).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 24.04.2 LTS) | x86_64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4810 |
| palomino8 | Windows Server 2022 Datacenter | x64 | 4.5.0 (2025-04-11 ucrt) -- "How About a Twenty-Six" | 4548 |
| kjohnson3 | macOS 13.7.1 Ventura | arm64 | 4.5.0 Patched (2025-04-21 r88169) -- "How About a Twenty-Six" | 4528 |
| taishan | Linux (openEuler 24.03 LTS) | aarch64 | 4.5.0 (2025-04-11) -- "How About a Twenty-Six" | 4493 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 727/2309 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 2.3.3 (landing page) Changqing Wang
| nebbiolo2 | Linux (Ubuntu 24.04.2 LTS) / x86_64 | OK | OK | OK | | ||||||||
| palomino8 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| kjohnson3 | macOS 13.7.1 Ventura / arm64 | OK | OK | OK | OK | | ||||||||
| taishan | Linux (openEuler 24.03 LTS) / aarch64 | ERROR | ERROR | skipped | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 2.3.3 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.3.tar.gz |
| StartedAt: 2025-06-18 19:15:18 -0400 (Wed, 18 Jun 2025) |
| EndedAt: 2025-06-18 19:22:07 -0400 (Wed, 18 Jun 2025) |
| EllapsedTime: 409.1 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.3.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.0 Patched (2025-04-21 r88169)
* using platform: aarch64-apple-darwin20
* R was compiled by
Apple clang version 16.0.0 (clang-1600.0.26.6)
GNU Fortran (GCC) 14.2.0
* running under: macOS Ventura 13.7.1
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.3.3’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 50 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable. Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.1.0.2.5)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
installed size is 12.3Mb
sub-directories of 1Mb or more:
bin 7.4Mb
data 1.8Mb
libs 1.6Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
almost never needs to use ::: for its own objects:
'barcode_demultiplex' 'gene_quantification' 'genome_alignment'
'isoform_identification' 'minimap2_align' 'read_realignment'
'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for ‘new’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
‘chisq.test’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_barcode: no visible binding for global variable ‘Sample’
find_barcode: no visible binding for global variable ‘Outfile’
find_variants_grange: no visible binding for global variable
‘which_label’
find_variants_grange: no visible binding for global variable
‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable
‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
reads’
plot_demultiplex_raw: no visible binding for global variable
‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
match reads’
plot_demultiplex_raw: no visible binding for global variable
‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_transcript_usage_chisq: no visible global function definition for
‘as’
sc_transcript_usage_chisq: no visible binding for global variable
‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘total’
sc_transcript_usage_permutation: no visible binding for global variable
‘test’
sc_transcript_usage_permutation: no visible global function definition
for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
‘cell_total_reads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘config’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘outdir’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘config’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
definition for ‘capture.output’
Undefined global functions or variables:
BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq
Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count as
bam_index barcode barcode_rank capture.output cell_total_reads
chisq.test config count counts_no_ins cumpct demultiplexed reads
download.file everything expr filter_res genome_bam head imageX
imageY in_tissue input j length_bin max_length min_length minimap2
multi-matching reads mutation_index n_reads na.omit name new
nucleotide outdir output p.value packageVersion pct pos
read1_with_adapter read_counts ref samtools scale_alpha_continuous
scale_colour_gradient single match reads starts_with test threads
total total reads total_counts tr_length transcript
transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
value which_label x y
Consider adding
importFrom("base", "match", "single")
importFrom("methods", "as", "new")
importFrom("stats", "chisq.test", "na.omit")
importFrom("utils", "capture.output", "download.file", "head",
"packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs/FLAMES.so’:
Found ‘___assert_rtn’, possibly from ‘assert’ (C)
Found ‘___stderrp’, possibly from ‘stderr’ (C)
Found ‘___stdoutp’, possibly from ‘stdout’ (C)
Found ‘_abort’, possibly from ‘abort’ (C)
Found ‘_exit’, possibly from ‘exit’ (C)
Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.
See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
plot_isoform_reduced_dim 9.189 0.129 9.338
sc_long_multisample_pipeline 7.924 1.021 5.846
find_variants 6.570 0.178 6.308
MultiSampleSCPipeline 5.440 0.645 7.334
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 4 NOTEs
See
‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.3.3’
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘Apple clang version 15.0.0 (clang-1500.1.0.2.5)’
using C++17
using SDK: ‘MacOSX11.3.sdk’
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
unsigned int end;
^
1 warning generated.
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch arm64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch arm64 -std=gnu2x -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/testthat/include' -I/opt/R/arm64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/bam.c -o utility/bam.o
clang++ -arch arm64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/arm64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
ld: warning: ignoring duplicate libraries: '-lz'
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for ARM64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2 -Wno-unused-result" arm_neon=1 aarch64=1 minimap2)
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -Isse2neon ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__ -Isse2neon ksw2_extz2_sse.c -o ksw2_extz2_neon.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__ -Isse2neon ksw2_extd2_sse.c -o ksw2_extd2_neon.o
cc -c -falign-functions=64 -Wall -g -O2 -Wno-unused-result -DHAVE_KALLOC -DKSW_SSE2_ONLY -D__SSE2__ -Isse2neon ksw2_exts2_sse.c -o ksw2_exts2_neon.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
cc -falign-functions=64 -Wall -g -O2 -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Building oarfish with cargo
mkdir -p ../inst/bin
mkdir cargo_temp
(cargo install oarfish --root cargo_temp --bin oarfish --vers 0.8.0)
Updating crates.io index
Installing oarfish v0.8.0
Updating crates.io index
Locking 263 packages to latest compatible versions
Adding noodles-bam v0.78.0 (available: v0.81.0)
Adding noodles-bgzf v0.38.0 (available: v0.41.0)
Adding noodles-sam v0.74.0 (available: v0.77.0)
Adding tabled v0.18.0 (available: v0.20.0)
Compiling libc v0.2.174
Compiling proc-macro2 v1.0.95
Compiling unicode-ident v1.0.18
Compiling shlex v1.3.0
Compiling cfg-if v1.0.1
Compiling autocfg v1.5.0
Compiling pkg-config v0.3.32
Compiling libm v0.2.15
Compiling memchr v2.7.5
Compiling zerocopy v0.8.26
Compiling crossbeam-utils v0.8.21
Compiling version_check v0.9.5
Compiling once_cell v1.21.3
Compiling adler2 v2.0.1
Compiling zlib-rs v0.5.1
Compiling static_assertions v1.1.0
Compiling regex-syntax v0.8.5
Compiling getrandom v0.3.3
Compiling serde v1.0.219
Compiling typenum v1.18.0
Compiling pin-project-lite v0.2.16
Compiling rawpointer v0.2.1
Compiling either v1.15.0
Compiling equivalent v1.0.2
Compiling crc32fast v1.4.2
Compiling futures-core v0.3.31
Compiling miniz_oxide v0.8.9
Compiling hashbrown v0.15.4
Compiling lexical-util v1.0.6
Compiling paste v1.0.15
Compiling futures-sink v0.3.31
Compiling pin-utils v0.1.0
Compiling futures-channel v0.3.31
Compiling heck v0.5.0
Compiling generic-array v0.14.7
Compiling semver v1.0.26
Compiling zstd-safe v7.2.4
Compiling slab v0.4.10
Compiling futures-io v0.3.31
Compiling futures-task v0.3.31
Compiling vcpkg v0.2.15
Compiling zstd-safe v6.0.6
Compiling bytecount v0.6.9
Compiling aho-corasick v1.1.3
Compiling num-traits v0.2.19
Compiling matrixmultiply v0.3.10
Compiling indexmap v2.9.0
Compiling bitflags v2.9.1
Compiling lexical-parse-integer v1.0.5
Compiling lexical-write-integer v1.0.5
Compiling num-complex v0.2.4
Compiling ahash v0.8.12
Compiling tracing-core v0.1.34
Compiling rayon-core v1.12.1
Compiling anyhow v1.0.98
Compiling regex-syntax v0.6.29
Compiling snap v1.1.1
Compiling bytes v1.10.1
Compiling itoa v1.0.15
Compiling quote v1.0.40
Compiling byteorder v1.5.0
Compiling rustversion v1.0.21
Compiling utf8parse v0.2.2
Compiling lazy_static v1.5.0
Compiling unicode-width v0.2.1
Compiling syn v2.0.103
Compiling crossbeam-channel v0.5.15
Compiling crossbeam-epoch v0.9.18
Compiling rustix v1.0.7
Compiling proc-macro-error-attr2 v2.0.0
Compiling anstyle-parse v0.2.7
Compiling crossbeam-deque v0.8.6
Compiling lexical-write-float v1.0.5
Compiling lexical-parse-float v1.0.5
Compiling buffer-redux v1.0.2
Compiling thiserror v1.0.69
Compiling jobserver v0.1.33
Compiling regex-automata v0.4.9
Compiling getrandom v0.2.16
Compiling errno v0.3.12
Compiling cc v1.2.27
Compiling rand_core v0.6.4
Compiling regex-automata v0.1.10
Compiling anstyle v1.0.11
Compiling array-init-cursor v0.2.1
Compiling anstyle-query v1.1.3
Compiling serde_json v1.0.140
Compiling ryu v1.0.20
Compiling fallible-streaming-iterator v0.1.9
Compiling portable-atomic v1.11.1
Compiling bit-vec v0.8.0
Compiling smallvec v1.15.1
Compiling overload v0.1.1
Compiling is_terminal_polyfill v1.70.1
Compiling colorchoice v1.0.4
Compiling log v0.4.27
Compiling anstream v0.6.19
Compiling nu-ansi-term v0.46.0
Compiling matchers v0.1.0
Compiling block-buffer v0.10.4
Compiling crypto-common v0.1.6
Compiling rustc_version v0.4.1
Compiling digest v0.10.7
Compiling tracing-log v0.2.0
Compiling streaming-decompression v0.1.2
Compiling planus v0.3.1
Compiling rand_core v0.9.3
Compiling arrow2 v0.18.0
Compiling cpufeatures v0.2.17
Compiling lexical-core v1.0.5
Compiling sharded-slab v0.1.7
Compiling itertools v0.13.0
Compiling twox-hash v1.6.3
Compiling ppv-lite86 v0.2.21
Compiling thread_local v1.1.9
Compiling fnv v1.0.7
Compiling num-integer v0.1.46
Compiling num-complex v0.4.6
Compiling rand_chacha v0.3.1
Compiling approx v0.5.1
Compiling libz-rs-sys v0.5.1
Compiling approx v0.3.2
Compiling flate2 v1.1.2
Compiling rand v0.8.5
Compiling zstd-sys v2.0.15+zstd.1.5.7
Compiling liblzma-sys v0.3.13
Compiling bzip2-sys v0.1.13+1.0.8
Compiling num-bigint v0.4.6
Compiling libz-sys v1.1.22
Compiling sha2-asm v0.6.4
Compiling lz4-sys v1.11.1+lz4-1.10.0
Compiling noodles-bgzf v0.38.0
Compiling ndarray v0.16.1
Compiling minimap2-sys v0.1.21+minimap2.2.28
Compiling rand_distr v0.4.3
Compiling num-iter v0.1.45
Compiling proc-macro-error2 v2.0.1
Compiling bstr v1.12.0
Compiling regex v1.11.1
Compiling noisy_float v0.2.0
Compiling strsim v0.11.1
Compiling clap_lex v0.7.5
Compiling fastrand v2.3.0
Compiling seq-macro v0.3.6
Compiling num-rational v0.4.2
Compiling noodles-core v0.17.0
Compiling alga v0.9.3
Compiling noodles-csi v0.46.0
Compiling clap_builder v4.5.40
Compiling rayon v1.10.0
Compiling hashbrown v0.14.5
Compiling serde_derive v1.0.219
Compiling bytemuck_derive v1.9.3
Compiling futures-macro v0.3.31
Compiling tracing-attributes v0.1.30
Compiling async-stream-impl v0.3.6
Compiling async-trait v0.1.88
Compiling bzip2 v0.4.4
Compiling thiserror-impl v1.0.69
Compiling noodles-sam v0.74.0
Compiling tempfile v3.20.0
Compiling num v0.4.3
Compiling async-stream v0.3.6
Compiling derive-new v0.6.0
Compiling clap_derive v4.5.40
Compiling liblzma v0.3.6
Compiling typed-builder-macro v0.21.0
Compiling strum_macros v0.26.4
Compiling ndarray v0.15.6
Compiling futures-util v0.3.31
Compiling rand_chacha v0.9.0
Compiling papergrid v0.14.0
Compiling lz4_flex v0.10.0
Compiling bytemuck v1.23.1
Compiling sha2 v0.10.9
Compiling chrono v0.4.41
Compiling tracing v0.1.41
Compiling num_cpus v1.17.0
Compiling console v0.15.11
Compiling tabled_derive v0.10.0
Compiling crossbeam-queue v0.3.12
Compiling csv-core v0.1.12
Compiling itertools v0.14.0
Compiling ethnum v1.5.2
Compiling base64 v0.21.7
Compiling streaming-iterator v0.1.9
Compiling base64 v0.22.1
Compiling number_prefix v0.4.0
Compiling hash_hasher v2.0.4
Compiling dyn-clone v1.0.19
Compiling foreign_vec v0.1.0
Compiling simdutf8 v0.1.5
Compiling hex v0.4.3
Compiling arrayvec v0.7.6
Compiling safe_arch v0.7.4
Compiling indicatif v0.17.11
Compiling typed-builder v0.21.0
Compiling wide v0.7.32
Compiling num-format v0.4.4
Compiling crossbeam v0.8.4
Compiling tabled v0.18.0
Compiling noodles-bam v0.78.0
Compiling rand v0.9.1
Compiling parse-size v1.1.0
Compiling atomic_float v1.1.0
Compiling clap v4.5.40
Compiling rustc-hash v2.1.1
Compiling tracing-subscriber v0.3.19
Compiling path-tools v0.1.0
Compiling simba v0.9.0
Compiling futures-executor v0.3.31
Compiling futures v0.3.31
Compiling ndarray-stats v0.6.0
Compiling parquet-format-safe v0.2.4
Compiling sprs v0.11.3
Compiling lz4 v1.28.1
Compiling bincode v1.3.3
Compiling arrow-format v0.8.1
Compiling bio-types v1.0.4
Compiling csv v1.3.1
Compiling kders v0.1.1
Compiling sendable-swapvec v0.4.3
Compiling zstd v0.12.4
Compiling nalgebra v0.33.2
Compiling parquet2 v0.17.2
Compiling zstd v0.13.3
Compiling needletail v0.6.3
Compiling minimap2 v0.1.23+minimap2.2.28
Compiling seqcol_rs v0.4.1
Compiling statrs v0.18.0
Compiling oarfish v0.8.0
Finished `release` profile [optimized] target(s) in 31.19s
Installing cargo_temp/bin/oarfish
Installed package `oarfish v0.8.0` (executable `oarfish`)
warning: be sure to add `cargo_temp/bin` to your PATH to be able to run the installed binaries
cp cargo_temp/bin/oarfish ../inst/bin/
cargo uninstall oarfish --root cargo_temp
Removing cargo_temp/bin/oarfish
rm -rf cargo_temp
installing to /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.0 Patched (2025-04-21 r88169) -- "How About a Twenty-Six"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: aarch64-apple-darwin20
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
>
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7151fe75/config_file_91022.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5a367616/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e770ad276/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e770ad276/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e632b744d/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e632b744d/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e632b744d/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e632b744d/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e543a89a7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e543a89a7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1af9b613/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1af9b613/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1af9b613/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1af9b613/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e543a89a7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6ab55644/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:02 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample1_align2genome.bam
[M::mm_idx_gen::0.001*2.96] collected minimizers
[M::mm_idx_gen::0.001*2.17] sorted minimizers
[M::main::0.001*2.10] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.00] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*1.93] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.091*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample1.fq.gz
[M::main] Real time: 0.091 sec; CPU: 0.093 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample2_align2genome.bam
[M::mm_idx_gen::0.000*5.37] collected minimizers
[M::mm_idx_gen::0.001*2.77] sorted minimizers
[M::main::0.001*2.64] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.48] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.34] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.091*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample2.fq.gz
[M::main] Real time: 0.092 sec; CPU: 0.093 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample3_align2genome.bam
[M::mm_idx_gen::0.000*5.24] collected minimizers
[M::mm_idx_gen::0.001*3.55] sorted minimizers
[M::main::0.001*3.43] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.23] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.06] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.165*1.01] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample3.fq.gz
[M::main] Real time: 0.165 sec; CPU: 0.167 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Wed Jun 18 19:19:03 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
[19:19:06] WARNING: src/learner.cc:553:
If you are loading a serialized model (like pickle in Python, RDS in R) generated by
older XGBoost, please export the model by calling `Booster.save_model` from that version
first, then load it back in current version. See:
https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html
for more details about differences between saving model and serializing.
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:19:12 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*6.74] collected minimizers
[M::mm_idx_gen::0.000*5.36] sorted minimizers
[M::main::0.000*5.20] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.88] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.59] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.039*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample1.fq.gz
[M::main] Real time: 0.039 sec; CPU: 0.040 sec; Peak RSS: 0.004 GB
Skipped sorting BAM files.
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample2_realign2transcript.bam
[M::mm_idx_gen::0.000*7.96] collected minimizers
[M::mm_idx_gen::0.000*6.47] sorted minimizers
[M::main::0.000*6.28] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*5.85] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*5.49] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.040*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample2.fq.gz
[M::main] Real time: 0.041 sec; CPU: 0.042 sec; Peak RSS: 0.004 GB
Skipped sorting BAM files.
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample3_realign2transcript.bam
[M::mm_idx_gen::0.000*6.27] collected minimizers
[M::mm_idx_gen::0.000*5.30] sorted minimizers
[M::main::0.000*5.17] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.87] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.60] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.075*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/fastq/sample3.fq.gz
[M::main] Real time: 0.075 sec; CPU: 0.077 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.
-- Running step: transcript_quantification @ Wed Jun 18 19:19:12 2025 ----------
[2m2025-06-18T23:19:12.763386Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:12.763924Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:19:12.763936Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:12.763940Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:12.763969Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:12.763974Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-06-18T23:19:12.765069Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-06-18T23:19:12.765139Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 253 │
│ aligned fraction too low │ 4 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 1 │
│ reads with valid best alignment │ 96 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:12.765153Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116
[2m2025-06-18T23:19:12.765155Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96
[2m2025-06-18T23:19:12.765157Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-06-18T23:19:12.766416Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-06-18T23:19:12.777049Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:12.777476Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:19:12.777540Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:12.777554Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:12.777584Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:12.777591Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-06-18T23:19:12.778750Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-06-18T23:19:12.778874Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 251 │
│ aligned fraction too low │ 5 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 2 │
│ reads with valid best alignment │ 95 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:12.778895Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114
[2m2025-06-18T23:19:12.778897Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95
[2m2025-06-18T23:19:12.778900Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82
[2m2025-06-18T23:19:12.780362Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-06-18T23:19:12.791719Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:12.792180Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e729bb7d7/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:19:12.792206Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:12.792210Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:12.792239Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:12.792245Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-06-18T23:19:12.794398Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2025-06-18T23:19:12.794470Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 398 │
│ aligned fraction too low │ 12 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 5 │
│ reads with valid best alignment │ 179 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:12.794485Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239
[2m2025-06-18T23:19:12.794488Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179
[2m2025-06-18T23:19:12.794490Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143
[2m2025-06-18T23:19:12.795806Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4e963f44/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:12 2025 -------------------
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:22 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample1_align2genome.bam
[M::mm_idx_gen::0.000*5.44] collected minimizers
[M::mm_idx_gen::0.001*3.39] sorted minimizers
[M::main::0.001*3.26] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.06] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.88] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.084*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample1.fq.gz
[M::main] Real time: 0.085 sec; CPU: 0.086 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample2_align2genome.bam
[M::mm_idx_gen::0.000*5.93] collected minimizers
[M::mm_idx_gen::0.001*3.77] sorted minimizers
[M::main::0.001*3.63] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.41] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.23] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.087*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample2.fq.gz
[M::main] Real time: 0.087 sec; CPU: 0.089 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample3_align2genome.bam
[M::mm_idx_gen::0.001*4.07] collected minimizers
[M::mm_idx_gen::0.001*2.58] sorted minimizers
[M::main::0.001*2.49] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.36] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.25] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.165*1.01] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample3.fq.gz
[M::main] Real time: 0.166 sec; CPU: 0.167 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Wed Jun 18 19:19:23 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|======================= | 33%
|
|=============================================== | 67%
|
|======================================================================| 100%
Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:19:28 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*6.10] collected minimizers
[M::mm_idx_gen::0.000*4.79] sorted minimizers
[M::main::0.000*4.50] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.28] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.09] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.033*1.04] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample1.fq.gz
[M::main] Real time: 0.033 sec; CPU: 0.035 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample2_realign2transcript.bam
[M::mm_idx_gen::0.000*7.75] collected minimizers
[M::mm_idx_gen::0.000*6.04] sorted minimizers
[M::main::0.000*5.70] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*5.36] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*5.08] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.033*1.05] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample2.fq.gz
[M::main] Real time: 0.033 sec; CPU: 0.035 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample3_realign2transcript.bam
[M::mm_idx_gen::0.000*6.66] collected minimizers
[M::mm_idx_gen::0.000*5.34] sorted minimizers
[M::main::0.000*5.06] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.79] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.57] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.065*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/fastq/sample3.fq.gz
[M::main] Real time: 0.065 sec; CPU: 0.066 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:19:28 2025 ----------
19:19:28 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e126d5782/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:29 2025 -------------------
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:39 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample1_align2genome.bam
[M::mm_idx_gen::0.000*5.74] collected minimizers
[M::mm_idx_gen::0.001*3.88] sorted minimizers
[M::main::0.001*3.79] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.50] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.28] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.083*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample1.fq.gz
[M::main] Real time: 0.084 sec; CPU: 0.085 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample2_align2genome.bam
[M::mm_idx_gen::0.000*5.19] collected minimizers
[M::mm_idx_gen::0.001*3.55] sorted minimizers
[M::main::0.001*3.48] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.24] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.04] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.083*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample2.fq.gz
[M::main] Real time: 0.084 sec; CPU: 0.085 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample3_align2genome.bam
[M::mm_idx_gen::0.000*5.27] collected minimizers
[M::mm_idx_gen::0.001*3.68] sorted minimizers
[M::main::0.001*3.62] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.39] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.19] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.163*1.01] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample3.fq.gz
[M::main] Real time: 0.164 sec; CPU: 0.165 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Wed Jun 18 19:19:40 2025 -------------
Inputs: ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6679bae9/transcript_assembly.fa.fai 5 0.4 0.4
Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:19:40 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*5.85] collected minimizers
[M::mm_idx_gen::0.000*4.29] sorted minimizers
[M::main::0.001*4.04] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.81] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.63] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.086*1.01] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample1.fq.gz
[M::main] Real time: 0.087 sec; CPU: 0.088 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample2_realign2transcript.bam
[M::mm_idx_gen::0.001*4.50] collected minimizers
[M::mm_idx_gen::0.001*3.60] sorted minimizers
[M::main::0.001*3.52] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.35] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.20] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.104*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample2.fq.gz
[M::main] Real time: 0.105 sec; CPU: 0.107 sec; Peak RSS: 0.005 GB
Skipped sorting BAM files.
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample3_realign2transcript.bam
[M::mm_idx_gen::0.001*5.09] collected minimizers
[M::mm_idx_gen::0.001*3.99] sorted minimizers
[M::main::0.001*3.87] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.67] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.48] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.197*1.01] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/fastq/sample3.fq.gz
[M::main] Real time: 0.198 sec; CPU: 0.200 sec; Peak RSS: 0.006 GB
Skipped sorting BAM files.
-- Running step: transcript_quantification @ Wed Jun 18 19:19:41 2025 ----------
[2m2025-06-18T23:19:41.162241Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:41.162516Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-06-18T23:19:41.162532Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:41.162536Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:41.162570Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:41.162576Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-06-18T23:19:41.164317Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-06-18T23:19:41.164383Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 707 │
│ aligned fraction too low │ 2 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 98 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:41.164399Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-06-18T23:19:41.164401Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-06-18T23:19:41.164403Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-06-18T23:19:41.165788Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-06-18T23:19:41.178321Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:41.178702Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-06-18T23:19:41.178734Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:41.178741Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:41.178790Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:41.178801Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-06-18T23:19:41.180972Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-06-18T23:19:41.181078Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 701 │
│ aligned fraction too low │ 3 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 97 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:41.181100Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-06-18T23:19:41.181103Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-06-18T23:19:41.181106Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-06-18T23:19:41.182574Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-06-18T23:19:41.199267Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:19:41.199598Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e205cd4d6/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-06-18T23:19:41.199621Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:19:41.199627Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:19:41.199667Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:19:41.199674Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-06-18T23:19:41.202938Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-06-18T23:19:41.203033Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m
discard_table:
╭─────────────────────────────────┬───────╮
│ reason │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end │ 0 │
│ too far from 3' end │ 0 │
│ score too low │ 1060 │
│ aligned fraction too low │ 6 │
│ aligned length too short │ 0 │
│ inconsistent orientation │ 0 │
│ supplementary alignment │ 0 │
│ reads with valid best alignment │ 187 │
╰─────────────────────────────────┴───────╯
[2m2025-06-18T23:19:41.203067Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-06-18T23:19:41.203070Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-06-18T23:19:41.203072Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-06-18T23:19:41.205879Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e6e424ec9/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:41 2025 -------------------
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:51 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample1_align2genome.bam
[M::mm_idx_gen::0.000*5.14] collected minimizers
[M::mm_idx_gen::0.001*3.41] sorted minimizers
[M::main::0.001*3.30] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.11] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.95] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.084*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample1.fq.gz
[M::main] Real time: 0.084 sec; CPU: 0.086 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample2_align2genome.bam
[M::mm_idx_gen::0.000*5.64] collected minimizers
[M::mm_idx_gen::0.001*3.63] sorted minimizers
[M::main::0.001*3.50] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.29] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.10] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.084*1.02] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample2.fq.gz
[M::main] Real time: 0.084 sec; CPU: 0.086 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample3_align2genome.bam
[M::mm_idx_gen::0.000*5.58] collected minimizers
[M::mm_idx_gen::0.001*3.69] sorted minimizers
[M::main::0.001*3.57] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.35] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.16] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.163*1.01] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample3.fq.gz
[M::main] Real time: 0.164 sec; CPU: 0.165 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: isoform_identification @ Wed Jun 18 19:19:51 2025 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:19:51 2025 -------------------
Realigning sample sample1 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*5.46] collected minimizers
[M::mm_idx_gen::0.000*4.10] sorted minimizers
[M::main::0.000*3.92] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.71] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.54] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.045*1.03] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample1.fq.gz
[M::main] Real time: 0.045 sec; CPU: 0.046 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample2 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample2_realign2transcript.bam
[M::mm_idx_gen::0.000*5.32] collected minimizers
[M::mm_idx_gen::0.000*4.05] sorted minimizers
[M::main::0.001*3.89] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.69] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.52] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.044*1.03] mapped 100 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample2.fq.gz
[M::main] Real time: 0.044 sec; CPU: 0.046 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample sample3 -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample3_realign2transcript.bam
[M::mm_idx_gen::0.000*5.64] collected minimizers
[M::mm_idx_gen::0.000*4.19] sorted minimizers
[M::main::0.000*3.99] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.001*3.77] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.001*3.58] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.083*1.02] mapped 193 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/fastq/sample3.fq.gz
[M::main] Real time: 0.084 sec; CPU: 0.085 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:19:52 2025 ----------
19:19:52 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5044740c/config_file_91022.json
Configured steps:
genome_alignment: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Wed Jun 18 19:19:52 2025 -------------------
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:02 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:02 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.55] collected minimizers
[M::mm_idx_gen::0.002*6.11] sorted minimizers
[M::main::0.002*5.93] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*5.75] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*5.58] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.074*7.06] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads.fastq.gz
[M::main] Real time: 0.075 sec; CPU: 0.521 sec; Peak RSS: 0.023 GB
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:20:02 2025 ----------------
19:20:02 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/align2genome.bam'
Inputs: ['/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample3_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample2_realign2transcript.bam', '/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/sample1_realign2transcript.bam'] /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536149a/transcript_assembly.fa.fai 5 0.4 0.4
Counter({'counted_reads': 391, 'not_enough_coverage': 2})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.09gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.09gene_group/s]
2025-06-18 19:20:03.908 R[91022:125834478] XType: Using static font registry.
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 53563.00Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:20:04 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:20:07 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/realign2transcript.bam
[M::mm_idx_gen::0.000*5.73] collected minimizers
[M::mm_idx_gen::0.002*7.12] sorted minimizers
[M::main::0.002*7.01] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*6.92] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*6.80] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.032*6.49] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 8 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.032 sec; CPU: 0.206 sec; Peak RSS: 0.013 GB
Sorting BAM files by 8 with CB threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Wed Jun 18 19:20:07 2025 ----------
[2m2025-06-18T23:20:07.405624Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:20:07.405942Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e19392e9c/realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:20:07.405969Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:20:07.405976Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:20:07.406020Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:20:07.406028Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-06-18T23:20:07.409486Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1a52ea2b/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:07 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1a52ea2b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:08 2025 -------------------
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:17 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:17 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*4.45] collected minimizers
[M::mm_idx_gen::0.002*6.64] sorted minimizers
[M::main::0.002*6.57] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*6.42] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*6.27] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.064*7.12] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads.fastq.gz
[M::main] Real time: 0.065 sec; CPU: 0.456 sec; Peak RSS: 0.024 GB
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:20:17 2025 ----------------
19:20:17 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 1.95gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 1.94gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 52268.60Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:20:18 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:20:21 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.63] collected minimizers
[M::mm_idx_gen::0.002*6.26] sorted minimizers
[M::main::0.002*6.01] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.002*5.88] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.002*5.81] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.033*5.03] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 8 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e2f4de37e/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.034 sec; CPU: 0.168 sec; Peak RSS: 0.011 GB
Sorting BAM files by genome coordinates with 8 threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:20:21 2025 ----------
19:20:21 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e560f0314/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:22 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e560f0314/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:22 2025 -------------------
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:31 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:31 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.73] collected minimizers
[M::mm_idx_gen::0.002*7.03] sorted minimizers
[M::main::0.002*6.89] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*6.71] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*6.55] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.067*7.18] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads.fastq.gz
[M::main] Real time: 0.068 sec; CPU: 0.484 sec; Peak RSS: 0.024 GB
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:20:31 2025 ----------------
19:20:31 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/align2genome.bam'
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.42gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.42gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 52962.66Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:20:32 2025 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:20:32 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/realign2transcript.bam
[M::mm_idx_gen::0.001*2.45] collected minimizers
[M::mm_idx_gen::0.003*5.61] sorted minimizers
[M::main::0.003*5.53] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.003*5.47] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.003*5.40] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.054*6.58] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 8 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.054 sec; CPU: 0.354 sec; Peak RSS: 0.014 GB
Sorting BAM files by 8 with CB threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Wed Jun 18 19:20:32 2025 ----------
[2m2025-06-18T23:20:32.992007Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:20:32.992289Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4c3418dd/realign2transcript.bam, contains 10 reference sequences.
[2m2025-06-18T23:20:32.992326Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:20:32.992334Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:20:32.992381Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:20:32.992392Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-06-18T23:20:32.999284Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e307dcfea/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:33 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e307dcfea/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:33 2025 -------------------
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:42 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:43 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.92] collected minimizers
[M::mm_idx_gen::0.002*6.68] sorted minimizers
[M::main::0.002*6.50] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.002*6.33] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*6.18] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.061*7.20] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 8 --seed 2022 --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads.fastq.gz
[M::main] Real time: 0.062 sec; CPU: 0.441 sec; Peak RSS: 0.024 GB
Sorting BAM files by genome coordinates with 8 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:20:43 2025 ----------------
19:20:43 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/align2genome.bam'
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.33gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 2.33gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 53495.23Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:20:43 2025 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:20:44 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.53] collected minimizers
[M::mm_idx_gen::0.002*6.83] sorted minimizers
[M::main::0.002*6.56] loaded/built the index for 10 target sequence(s)
[M::mm_mapopt_update::0.002*6.37] mid_occ = 11
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 10
[M::mm_idx_stat::0.002*6.26] distinct minimizers: 611 (72.01% are singletons); average occurrences: 2.597; average spacing: 5.171; total length: 8207
[M::worker_pipeline::0.033*6.74] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 8 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e71b99a95/matched_reads_dedup.fastq.gz
[M::main] Real time: 0.034 sec; CPU: 0.226 sec; Peak RSS: 0.012 GB
Sorting BAM files by genome coordinates with 8 threads...
[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:20:44 2025 ----------
19:20:44 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e109ce3fa/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:44 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 8
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e109ce3fa/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:44 2025 -------------------
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:20:54 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:20:55 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.92] collected minimizers
[M::mm_idx_gen::0.001*3.48] sorted minimizers
[M::main::0.001*3.39] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.18] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.00] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.299*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.299 sec; CPU: 0.300 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.36] collected minimizers
[M::mm_idx_gen::0.001*3.86] sorted minimizers
[M::main::0.001*3.78] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.53] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.32] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.075*1.02] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.076 sec; CPU: 0.077 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*6.00] collected minimizers
[M::mm_idx_gen::0.001*3.82] sorted minimizers
[M::main::0.001*3.68] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.45] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.26] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.077*1.02] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.078 sec; CPU: 0.080 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.43] collected minimizers
[M::mm_idx_gen::0.001*3.73] sorted minimizers
[M::main::0.001*3.64] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.40] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*3.18] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.151*1.01] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.151 sec; CPU: 0.152 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:20:55 2025 ----------------
19:20:55 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_align2genome.bam'
Counter({'counted_reads': 358})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 57.10gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 52557.30Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 156.96gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 259093.18Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 151.68gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 211594.16Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 102.29gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 106942.99Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:20:56 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:21:03 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_realign2transcript.bam
[M::mm_idx_gen::0.000*6.83] collected minimizers
[M::mm_idx_gen::0.000*5.53] sorted minimizers
[M::main::0.000*5.34] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.98] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.67] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.129*1.01] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.129 sec; CPU: 0.131 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*6.84] collected minimizers
[M::mm_idx_gen::0.000*5.62] sorted minimizers
[M::main::0.000*5.42] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*5.08] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.80] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.033*1.05] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.034 sec; CPU: 0.035 sec; Peak RSS: 0.004 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_realign2transcript.bam
[M::mm_idx_gen::0.000*6.90] collected minimizers
[M::mm_idx_gen::0.000*5.50] sorted minimizers
[M::main::0.000*5.23] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.93] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.58] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.037*1.04] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.037 sec; CPU: 0.039 sec; Peak RSS: 0.004 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_realign2transcript.bam
[M::mm_idx_gen::0.000*6.37] collected minimizers
[M::mm_idx_gen::0.000*5.17] sorted minimizers
[M::main::0.000*4.97] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.65] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.36] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.066*1.01] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.066 sec; CPU: 0.067 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...
-- Running step: transcript_quantification @ Wed Jun 18 19:21:04 2025 ----------
[2m2025-06-18T23:21:04.082057Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:04.082285Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sampleA_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:21:04.082300Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:04.082305Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:04.082348Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:04.082359Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-06-18T23:21:04.086456Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:04.494819Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:04.495086Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:21:04.495103Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:04.495109Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:04.495148Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:04.495163Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:04.938620Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:04.938967Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:21:04.938999Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:04.939006Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:04.939054Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:04.939064Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:05.364512Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:05.364761Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e17441e9/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-06-18T23:21:05.364792Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:05.364799Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:05.364832Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:05.364839Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:05 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e5e75dd3f/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:06 2025 -------------------
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:15 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:16 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.81] collected minimizers
[M::mm_idx_gen::0.001*3.29] sorted minimizers
[M::main::0.001*3.21] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.02] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.86] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.299*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.299 sec; CPU: 0.301 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.42] collected minimizers
[M::mm_idx_gen::0.001*3.12] sorted minimizers
[M::main::0.001*3.06] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.88] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.72] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.077*1.02] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.077 sec; CPU: 0.079 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.96] collected minimizers
[M::mm_idx_gen::0.001*3.17] sorted minimizers
[M::main::0.001*3.03] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.86] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.71] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.078*1.02] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.079 sec; CPU: 0.080 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.45] collected minimizers
[M::mm_idx_gen::0.001*3.00] sorted minimizers
[M::main::0.001*2.91] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.78] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.66] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.153*1.01] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.154 sec; CPU: 0.155 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:21:17 2025 ----------------
19:21:17 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 63.59gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 52934.59Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 140.08gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 256093.78Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 152.32gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 209748.76Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 106.24gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 105982.07Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:21:17 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
|
| | 0%
|
|================== | 25%
|
|=================================== | 50%
|
|==================================================== | 75%
|
|======================================================================| 100%
Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:21:24 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*7.40] collected minimizers
[M::mm_idx_gen::0.000*5.79] sorted minimizers
[M::main::0.000*5.51] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*5.20] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.92] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.111*1.02] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.111 sec; CPU: 0.113 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*6.75] collected minimizers
[M::mm_idx_gen::0.000*5.25] sorted minimizers
[M::main::0.000*4.95] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*4.68] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*4.45] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.029*1.05] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.029 sec; CPU: 0.031 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.49] collected minimizers
[M::mm_idx_gen::0.000*4.56] sorted minimizers
[M::main::0.000*4.35] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.001*4.16] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.001*3.98] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.031*1.05] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.031 sec; CPU: 0.033 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*7.20] collected minimizers
[M::mm_idx_gen::0.000*6.01] sorted minimizers
[M::main::0.000*5.85] loaded/built the index for 5 target sequence(s)
[M::mm_mapopt_update::0.000*5.51] mid_occ = 10
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 5
[M::mm_idx_stat::0.000*5.21] distinct minimizers: 198 (33.33% are singletons); average occurrences: 2.884; average spacing: 5.196; total length: 2967
[M::worker_pipeline::0.056*1.03] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.056 sec; CPU: 0.058 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:21:24 2025 ----------
19:21:24 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7c670ef0/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:25 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e7a7e0e5/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:26 2025 -------------------
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:35 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:35 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.98] collected minimizers
[M::mm_idx_gen::0.001*3.24] sorted minimizers
[M::main::0.001*3.14] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.96] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.80] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.306*1.00] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.306 sec; CPU: 0.306 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.31] collected minimizers
[M::mm_idx_gen::0.001*3.16] sorted minimizers
[M::main::0.001*3.11] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.93] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.78] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.076*1.02] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.077 sec; CPU: 0.078 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.88] collected minimizers
[M::mm_idx_gen::0.001*3.19] sorted minimizers
[M::main::0.001*3.06] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.88] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.73] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.079*1.00] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.080 sec; CPU: 0.080 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.48] collected minimizers
[M::mm_idx_gen::0.001*3.17] sorted minimizers
[M::main::0.001*3.10] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.93] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.77] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.151*1.01] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.151 sec; CPU: 0.152 sec; Peak RSS: 0.007 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:21:36 2025 ----------------
19:21:36 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_align2genome.bam'
Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
Counter({'counted_reads': 92, 'not_enough_coverage': 3})
Counter({'counted_reads': 89, 'not_enough_coverage': 2})
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 68.00gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 54116.14Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 160.64gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 261047.60Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 133.39gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 214331.91Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 111.27gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 106418.76Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:21:37 2025 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:21:37 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_realign2transcript.bam
[M::mm_idx_gen::0.000*4.87] collected minimizers
[M::mm_idx_gen::0.001*4.05] sorted minimizers
[M::main::0.001*3.97] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.77] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.60] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.346*1.00] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.346 sec; CPU: 0.348 sec; Peak RSS: 0.007 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_realign2transcript.bam
[M::mm_idx_gen::0.000*4.64] collected minimizers
[M::mm_idx_gen::0.001*3.66] sorted minimizers
[M::main::0.001*3.53] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.36] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.21] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.094*1.01] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.094 sec; CPU: 0.095 sec; Peak RSS: 0.005 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_realign2transcript.bam
[M::mm_idx_gen::0.000*4.72] collected minimizers
[M::mm_idx_gen::0.001*3.71] sorted minimizers
[M::main::0.001*3.57] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.40] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.26] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.097*1.01] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.097 sec; CPU: 0.098 sec; Peak RSS: 0.004 GB
Sorting BAM files by 1 with CB threads...
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_realign2transcript.bam
[M::mm_idx_gen::0.000*4.37] collected minimizers
[M::mm_idx_gen::0.001*3.42] sorted minimizers
[M::main::0.001*3.28] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.13] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.00] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.163*1.01] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 --eqx -N 100 -ax map-ont -t 1 --seed 2022 -y /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.163 sec; CPU: 0.165 sec; Peak RSS: 0.006 GB
Sorting BAM files by 1 with CB threads...
-- Running step: transcript_quantification @ Wed Jun 18 19:21:38 2025 ----------
[2m2025-06-18T23:21:38.329675Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:38.329962Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-06-18T23:21:38.329979Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:38.329984Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:38.330026Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:38.330033Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-06-18T23:21:38.336855Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:38.901139Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:38.901394Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-06-18T23:21:38.901410Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:38.901418Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:38.901457Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:38.901464Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:39.382974Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:39.383248Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-06-18T23:21:39.383264Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:39.383269Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:39.383309Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:39.383319Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
[2m2025-06-18T23:21:39.854697Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-06-18T23:21:39.854973Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e74ea69ad/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-06-18T23:21:39.855007Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-06-18T23:21:39.855016Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-06-18T23:21:39.855060Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-06-18T23:21:39.855072Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:40 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e536bdac0/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:40 2025 -------------------
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:50 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:50 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.001*5.09] collected minimizers
[M::mm_idx_gen::0.001*3.33] sorted minimizers
[M::main::0.001*3.23] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.07] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.002*2.92] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.310*1.01] mapped 372 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads.fastq.gz
[M::main] Real time: 0.311 sec; CPU: 0.312 sec; Peak RSS: 0.008 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.62] collected minimizers
[M::mm_idx_gen::0.001*3.52] sorted minimizers
[M::main::0.001*3.38] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.16] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.98] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.075*1.02] mapped 93 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads.fastq.gz
[M::main] Real time: 0.076 sec; CPU: 0.077 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.24] collected minimizers
[M::mm_idx_gen::0.001*3.44] sorted minimizers
[M::main::0.001*3.32] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*3.12] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.94] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.078*1.02] mapped 96 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads.fastq.gz
[M::main] Real time: 0.078 sec; CPU: 0.080 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Aligning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.68] collected minimizers
[M::mm_idx_gen::0.001*3.23] sorted minimizers
[M::main::0.001*3.13] loaded/built the index for 1 target sequence(s)
[M::mm_mapopt_update::0.001*2.95] mid_occ = 10
[M::mm_idx_stat] kmer size: 14; skip: 5; is_hpc: 0; #seq: 1
[M::mm_idx_stat::0.001*2.82] distinct minimizers: 1763 (99.72% are singletons); average occurrences: 1.005; average spacing: 2.918; total length: 5170
[mm_idx_bed_read_merge] read 93 introns, 45 of which are non-redundant
[M::worker_pipeline::0.150*1.01] mapped 183 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax splice -k14 --secondary=no -t 1 --seed 2022 --splice-flank=no --junc-bed /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/reference.bed --junc-bonus 1 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/rps24.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads.fastq.gz
[M::main] Real time: 0.151 sec; CPU: 0.152 sec; Peak RSS: 0.006 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: gene_quantification @ Wed Jun 18 19:21:51 2025 ----------------
19:21:51 Wed Jun 18 2025 quantify genes
Using BAM(s):
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_align2genome.bam',
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_align2genome.bam',
and
'/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_align2genome.bam'
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 65.40gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 54488.75Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 158.16gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 256225.20Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 155.52gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 210013.42Read/s]
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_align2genome.bam...
Assigning reads to genes...
Processed: 0%| | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 111.55gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...
Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 105734.14Read/s]
-- Running step: isoform_identification @ Wed Jun 18 19:21:52 2025 -------------
#### Read gene annotations
Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
Import genomic features from the file as a GRanges object ... OK
Prepare the 'metadata' data frame ... OK
Make the TxDb object ... OK
-- Running step: read_realignment @ Wed Jun 18 19:21:52 2025 -------------------
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample1.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample2.fq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/fastq/sample3.fq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads.fastq.gz
files found
Checking for fastq file(s) /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads_dedup.fastq.gz, /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads_dedup.fastq.gz
files found
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.56] collected minimizers
[M::mm_idx_gen::0.001*3.63] sorted minimizers
[M::main::0.001*3.49] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.34] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.20] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.172*1.01] mapped 358 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.173 sec; CPU: 0.174 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.47] collected minimizers
[M::mm_idx_gen::0.001*3.50] sorted minimizers
[M::main::0.001*3.36] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.21] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.08] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.045*1.03] mapped 91 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.045 sec; CPU: 0.047 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*4.40] collected minimizers
[M::mm_idx_gen::0.001*3.71] sorted minimizers
[M::main::0.001*3.61] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.46] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.32] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.045*1.04] mapped 95 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.045 sec; CPU: 0.047 sec; Peak RSS: 0.004 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
Realigning sample /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads_dedup.fastq.gz -> /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
[M::mm_idx_gen::0.000*5.35] collected minimizers
[M::mm_idx_gen::0.001*4.19] sorted minimizers
[M::main::0.001*4.00] loaded/built the index for 14 target sequence(s)
[M::mm_mapopt_update::0.001*3.80] mid_occ = 15
[M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 14
[M::mm_idx_stat::0.001*3.63] distinct minimizers: 632 (64.56% are singletons); average occurrences: 3.326; average spacing: 5.176; total length: 10880
[M::worker_pipeline::0.086*1.02] mapped 176 sequences
[M::main] Version: 2.29-r1283
[M::main] CMD: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/library/FLAMES/bin/minimap2 -ax map-ont -p 0.9 --end-bonus 10 -N 3 -t 1 --seed 2022 /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/transcript_assembly.fa /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_matched_reads_dedup.fastq.gz
[M::main] Real time: 0.086 sec; CPU: 0.088 sec; Peak RSS: 0.005 GB
Sorting BAM files by genome coordinates with 1 threads...
Indexing bam files
-- Running step: transcript_quantification @ Wed Jun 18 19:21:52 2025 ----------
19:21:52 Wed Jun 18 2025 quantify transcripts
Found realignment file(s): sample1_realign2transcript.bam
sample2_realign2transcript.bam
sample3_realign2transcript.bam
sampleA_realign2transcript.bam
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample3_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sampleA_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample2_realign2transcript.bamdone
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_realign2transcript.bam...
parsing /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e4be64d39/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/config_file_91022.json
Configured steps:
barcode_demultiplex: TRUE
genome_alignment: TRUE
gene_quantification: TRUE
isoform_identification: TRUE
read_realignment: TRUE
transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Wed Jun 18 19:21:53 2025 ----------------
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /var/folders/r0/l4fjk6cj5xj0j3brt4bplpl40000gt/T//Rtmpgh968L/file1638e1c8591b2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
-- Running step: genome_alignment @ Wed Jun 18 19:21:54 2025 -------------------
[ FAIL 0 | WARN 150 | SKIP 0 | PASS 37 ]
[ FAIL 0 | WARN 150 | SKIP 0 | PASS 37 ]
Counter({'counted_reads': 175, 'not_enough_coverage': 1})
Counter({'counted_reads': 357, 'not_enough_coverage': 1})
Counter({'counted_reads': 95})
Counter({'counted_reads': 91})
>
> proc.time()
user system elapsed
171.168 13.777 190.547
/Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
warnings.warn('resource_tracker: There appear to be %d '
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| BulkPipeline | 2.793 | 0.229 | 3.544 | |
| MultiSampleSCPipeline | 5.440 | 0.645 | 7.334 | |
| SingleCellPipeline | 2.644 | 0.345 | 1.882 | |
| add_gene_counts | 0.082 | 0.005 | 0.088 | |
| annotation_to_fasta | 0.198 | 0.008 | 0.223 | |
| blaze | 2.693 | 0.353 | 3.056 | |
| bulk_long_pipeline | 1.767 | 0.413 | 1.507 | |
| combine_sce | 0.218 | 0.055 | 0.274 | |
| controllers-set | 0.770 | 0.166 | 0.939 | |
| controllers | 0.110 | 0.126 | 0.239 | |
| convolution_filter | 0.000 | 0.001 | 0.001 | |
| create_config | 0.002 | 0.000 | 0.002 | |
| create_sce_from_dir | 2.391 | 0.413 | 1.816 | |
| create_se_from_dir | 1.212 | 0.330 | 1.555 | |
| cutadapt | 0.047 | 0.015 | 0.068 | |
| example_pipeline | 0.099 | 0.014 | 0.116 | |
| experiment | 1.110 | 0.165 | 1.292 | |
| filter_annotation | 0.150 | 0.003 | 0.154 | |
| filter_coverage | 0.583 | 0.165 | 0.753 | |
| find_barcode | 0.432 | 0.067 | 0.498 | |
| find_bin | 0.002 | 0.006 | 0.008 | |
| find_variants | 6.570 | 0.178 | 6.308 | |
| get_coverage | 0.593 | 0.132 | 0.751 | |
| index_genome | 0.098 | 0.093 | 0.199 | |
| mutation_positions | 0.704 | 0.056 | 0.812 | |
| plot_coverage | 0.981 | 0.158 | 1.148 | |
| plot_demultiplex | 0.778 | 0.236 | 1.028 | |
| plot_demultiplex_raw | 0.407 | 0.032 | 0.443 | |
| plot_isoform_heatmap | 2.489 | 0.109 | 2.608 | |
| plot_isoform_reduced_dim | 9.189 | 0.129 | 9.338 | |
| plot_isoforms | 0.902 | 0.006 | 0.922 | |
| resume_FLAMES | 1.211 | 0.216 | 1.450 | |
| run_FLAMES | 1.140 | 0.143 | 1.300 | |
| run_step | 0.510 | 0.159 | 0.678 | |
| sc_DTU_analysis | 4.397 | 0.551 | 3.870 | |
| sc_impute_transcript | 0.179 | 0.002 | 0.181 | |
| sc_long_multisample_pipeline | 7.924 | 1.021 | 5.846 | |
| sc_long_pipeline | 2.725 | 0.353 | 1.928 | |
| sc_mutations | 1.455 | 0.221 | 1.289 | |
| show-FLAMESPipeline | 0.101 | 0.014 | 0.116 | |
| steps-set | 0.140 | 0.014 | 0.155 | |
| steps | 0.048 | 0.013 | 0.061 | |
| weight_transcripts | 0.008 | 0.004 | 0.012 | |