| Back to Multiple platform build/check report for BioC 3.18: simplified long |
|
This page was generated on 2024-04-17 11:37:43 -0400 (Wed, 17 Apr 2024).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | 4.3.3 (2024-02-29) -- "Angel Food Cake" | 4676 |
| palomino4 | Windows Server 2022 Datacenter | x64 | 4.3.3 (2024-02-29 ucrt) -- "Angel Food Cake" | 4414 |
| merida1 | macOS 12.7.1 Monterey | x86_64 | 4.3.3 (2024-02-29) -- "Angel Food Cake" | 4437 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 716/2266 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 1.8.0 (landing page) Oliver Voogd
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | OK | |||||||||
| palomino4 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| merida1 | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | |||||||||
| kjohnson1 | macOS 13.6.1 Ventura / arm64 | see weekly results here | ||||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
| Package: FLAMES |
| Version: 1.8.0 |
| Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.8.0.tar.gz |
| StartedAt: 2024-04-16 02:51:27 -0400 (Tue, 16 Apr 2024) |
| EndedAt: 2024-04-16 03:09:30 -0400 (Tue, 16 Apr 2024) |
| EllapsedTime: 1083.5 seconds |
| RetCode: 0 |
| Status: OK |
| CheckDir: FLAMES.Rcheck |
| Warnings: 0 |
##############################################################################
##############################################################################
###
### Running command:
###
### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.8.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/Users/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck’
* using R version 4.3.3 (2024-02-29)
* using platform: x86_64-apple-darwin20 (64-bit)
* R was compiled by
Apple clang version 14.0.0 (clang-1400.0.29.202)
GNU Fortran (GCC) 12.2.0
* running under: macOS Monterey 12.7.1
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.8.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
.BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.sdk’
* checking C++ specification ... OK
Not all R platforms support C++17
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotation_to_fasta: no visible global function definition for
'write.table'
generate_sc_sce: no visible binding for global variable 'FSM_match'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
variable 'heatmap_annotation_colors'
sc_umap_expression: no visible binding for global variable
'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
'x'
sc_umap_expression : plot_idx: no visible binding for global variable
'y'
transcript_coverage: no visible binding for global variable 'mat'
Undefined global functions or variables:
. BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt
everything gene_id heatmap_annotation_colors label length_bin mat n
name tr_id transcript transcript_id value write.table x y
Consider adding
importFrom("utils", "write.table")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
user system elapsed
sc_heatmap_expression 63.873 0.933 67.248
sc_umap_expression 55.391 0.612 59.157
sc_reduce_dims 27.584 0.367 27.974
quantify_transcript 5.624 0.337 6.271
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 5 NOTEs
See
‘/Users/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c flexiplex.cpp -o flexiplex.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.3-x86_64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.3.3 (2024-02-29) -- "Angel Food Cake"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20 (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /tmp/RtmpA1VVJ6/filec69a4364bf2b/config_file_50842.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpA1VVJ6/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
>
> proc.time()
user system elapsed
40.340 2.279 44.835
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed | |
| annotation_to_fasta | 2.804 | 0.310 | 3.279 | |
| blaze | 0.537 | 0.148 | 2.274 | |
| bulk_long_pipeline | 1.079 | 0.223 | 1.848 | |
| combine_sce | 3.286 | 0.037 | 3.391 | |
| create_config | 0.014 | 0.003 | 0.019 | |
| create_sce_from_dir | 0.334 | 0.043 | 0.393 | |
| create_se_from_dir | 1.061 | 0.189 | 1.328 | |
| cutadapt | 0.000 | 0.001 | 0.001 | |
| filter_annotation | 1.494 | 0.010 | 1.594 | |
| find_barcode | 0.213 | 0.020 | 0.244 | |
| find_isoform | 1.187 | 0.128 | 1.749 | |
| get_GRangesList | 2.306 | 0.119 | 2.462 | |
| locate_minimap2_dir | 0.003 | 0.006 | 0.010 | |
| minimap2_align | 0.921 | 0.113 | 1.055 | |
| minimap2_realign | 1.084 | 0.112 | 1.215 | |
| parse_gff_tree | 0.451 | 0.030 | 0.489 | |
| plot_coverage | 1.623 | 0.114 | 1.798 | |
| plot_demultiplex | 0.932 | 0.056 | 0.997 | |
| quantify_transcript | 5.624 | 0.337 | 6.271 | |
| sc_DTU_analysis | 0.258 | 0.026 | 0.317 | |
| sc_heatmap_expression | 63.873 | 0.933 | 67.248 | |
| sc_long_multisample_pipeline | 2.328 | 0.128 | 2.633 | |
| sc_long_pipeline | 0.266 | 0.025 | 0.308 | |
| sc_mutations | 0.349 | 0.026 | 0.408 | |
| sc_reduce_dims | 27.584 | 0.367 | 27.974 | |
| sc_umap_expression | 55.391 | 0.612 | 59.157 | |