Multiple platform build/check report for BioC 3.22 - CHECK results for FLAMES on lconway

Hostname	OS	Arch (*)	R version	Installed pkgs
nebbiolo2	Linux (Ubuntu 24.04.3 LTS)	x86_64	4.5.1 Patched (2025-08-23 r88802) -- "Great Square Root"	4887
lconway	macOS 12.7.6 Monterey	x86_64	4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root"	4677
kjohnson3	macOS 13.7.7 Ventura	arm64	4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root"	4622
taishan	Linux (openEuler 24.03 LTS)	aarch64	4.5.0 (2025-04-11) -- "How About a Twenty-Six"	4632
Click on any hostname to see more info about the system (e.g. compilers) () as reported by 'uname -p', except on Windows and Mac OS X*

CHECK results for FLAMES on lconway

To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results

Summary

Package: FLAMES

Version: 2.3.5

Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.5.tar.gz

StartedAt: 2025-10-17 22:10:07 -0400 (Fri, 17 Oct 2025)

EndedAt: 2025-10-17 22:42:22 -0400 (Fri, 17 Oct 2025)

EllapsedTime: 1935.1 seconds

RetCode: 0

Status: OK

CheckDir: FLAMES.Rcheck

Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_2.3.5.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’
* using R version 4.5.1 Patched (2025-09-10 r88807)
* using platform: x86_64-apple-darwin20
* R was compiled by
    Apple clang version 14.0.0 (clang-1400.0.29.202)
    GNU Fortran (GCC) 14.2.0
* running under: macOS Monterey 12.7.6
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* this is package ‘FLAMES’ version ‘2.3.5’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... INFO
Imports includes 47 non-default packages.
Importing from so many packages makes the package vulnerable to any of
them becoming unavailable.  Move as many as possible to Suggests and
use conditionally.
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .dockerignore
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
* used SDK: ‘MacOSX11.3.1.sdk’
* checking C++ specification ... OK
* checking installed package size ... INFO
  installed size is  5.5Mb
  sub-directories of 1Mb or more:
    data   1.8Mb
    libs   1.8Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking dependencies in R code ... NOTE
There are ::: calls to the package's namespace in its code. A package
  almost never needs to use ::: for its own objects:
  'blaze' 'find_barcode' 'gene_quantification' 'isoform_identification'
  'minimap2_align' 'transcript_quantification'
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
BulkPipeline: no visible global function definition for ‘new’
BulkPipeline: no visible global function definition for ‘setNames’
MultiSampleSCPipeline: no visible global function definition for ‘new’
MultiSampleSCPipeline: no visible global function definition for
  ‘setNames’
SingleCellPipeline: no visible global function definition for ‘new’
SingleCellPipeline: no visible global function definition for
  ‘setNames’
addRowRanges: no visible global function definition for ‘head’
addRowRanges: no visible global function definition for ‘as’
add_gene_counts: no visible global function definition for ‘as’
cache_dir: no visible global function definition for ‘packageVersion’
chisq_test_by_gene: no visible global function definition for
  ‘chisq.test’
create_sce_from_dir: no visible global function definition for
  ‘setNames’
create_spe: no visible binding for global variable ‘barcode’
create_spe: no visible binding for global variable ‘in_tissue’
download_oarfish: no visible global function definition for
  ‘download.file’
download_oarfish: no visible global function definition for ‘unzip’
filter_coverage: no visible global function definition for
  ‘starts_with’
filter_coverage: no visible binding for global variable ‘filter_res’
find_variants: no visible global function definition for ‘setNames’
find_variants_grange: no visible binding for global variable
  ‘which_label’
find_variants_grange: no visible binding for global variable
  ‘nucleotide’
find_variants_grange: no visible binding for global variable ‘pos’
find_variants_grange: no visible binding for global variable ‘count’
find_variants_grange: no visible binding for global variable
  ‘counts_no_ins’
find_variants_grange: no visible binding for global variable ‘ref’
generate_sc_sce: no visible binding for global variable ‘FSM_match’
get_coverage: no visible binding for global variable ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘Freq’
homopolymer_pct : <anonymous>: no visible binding for global variable
  ‘pct’
plot_coverage: no visible binding for global variable ‘tr_length’
plot_coverage: no visible binding for global variable ‘read_counts’
plot_coverage: no visible binding for global variable ‘total_counts’
plot_coverage: no visible binding for global variable ‘cumpct’
plot_coverage: no visible binding for global variable ‘length_bin’
plot_coverage: no visible binding for global variable ‘min_length’
plot_coverage: no visible binding for global variable ‘max_length’
plot_coverage: no visible global function definition for ‘head’
plot_coverage: no visible binding for global variable ‘transcript’
plot_demultiplex_raw: no visible binding for global variable ‘Sample’
plot_demultiplex_raw: no visible binding for global variable
  ‘CellBarcode’
plot_demultiplex_raw: no visible binding for global variable ‘UMI’
plot_demultiplex_raw: no visible binding for global variable
  ‘UMI_count’
plot_demultiplex_raw: no visible binding for global variable
  ‘barcode_rank’
plot_demultiplex_raw: no visible binding for global variable
  ‘FlankEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘n_reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘BarcodeEditDist’
plot_demultiplex_raw: no visible binding for global variable ‘total
  reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘demultiplexed reads’
plot_demultiplex_raw: no visible binding for global variable ‘single
  match reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘undemultiplexted reads’
plot_demultiplex_raw: no visible binding for global variable
  ‘multi-matching reads’
plot_demultiplex_raw: no visible binding for global variable ‘Type’
plot_demultiplex_raw: no visible binding for global variable ‘Reads’
plot_demultiplex_raw: no visible binding for global variable ‘input’
plot_demultiplex_raw: no visible binding for global variable ‘output’
plot_demultiplex_raw: no visible binding for global variable
  ‘read1_with_adapter’
plot_demultiplex_raw: no visible binding for global variable ‘Count’
plot_flagstat: no visible global function definition for ‘everything’
plot_flagstat: no visible binding for global variable ‘name’
plot_flagstat: no visible binding for global variable ‘value’
plot_isoform_reduced_dim: no visible binding for global variable ‘x’
plot_isoform_reduced_dim: no visible binding for global variable ‘y’
plot_isoform_reduced_dim: no visible binding for global variable ‘expr’
plot_spatial: no visible binding for global variable ‘imageX’
plot_spatial: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘imageX’
plot_spatial_feature: no visible binding for global variable ‘imageY’
plot_spatial_feature: no visible binding for global variable ‘x’
plot_spatial_feature: no visible binding for global variable ‘y’
plot_spatial_feature: no visible global function definition for
  ‘scale_alpha_continuous’
plot_spatial_feature: no visible global function definition for
  ‘scale_colour_gradient’
plot_spatial_isoform: no visible global function definition for ‘head’
plot_spatial_pie: no visible global function definition for ‘setNames’
plot_spatial_pie: no visible global function definition for ‘head’
plot_spatial_pie: no visible binding for global variable ‘imageX’
plot_spatial_pie: no visible binding for global variable ‘imageY’
sc_gene_entropy: no visible global function definition for ‘as’
sc_genotype: no visible binding for global variable ‘allele’
sc_genotype: no visible binding for global variable ‘allele_count’
sc_genotype: no visible binding for global variable ‘barcode’
sc_genotype: no visible binding for global variable ‘pct’
sc_mutations: no visible binding for global variable ‘mutation_index’
sc_mutations: no visible binding for global variable ‘bam_index’
sc_plot_genotype: no visible global function definition for ‘setNames’
sc_plot_genotype: no visible binding for global variable ‘barcode’
sc_plot_genotype: no visible binding for global variable ‘genotype’
sc_plot_genotype: no visible binding for global variable ‘x’
sc_plot_genotype: no visible binding for global variable ‘y’
sc_transcript_usage_chisq: no visible global function definition for
  ‘as’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_chisq: no visible binding for global variable
  ‘adj.p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘total’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘test’
sc_transcript_usage_permutation: no visible global function definition
  for ‘as’
sc_transcript_usage_permutation : <anonymous>: no visible global
  function definition for ‘as’
sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible
  global function definition for ‘na.omit’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘transcript’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘p.value’
sc_transcript_usage_permutation: no visible binding for global variable
  ‘adj.p.value’
variant_count_tb: no visible binding for global variable ‘barcode’
variant_count_tb: no visible binding for global variable ‘allele_count’
variant_count_tb: no visible binding for global variable
  ‘cell_total_reads’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible binding
  for global variable ‘outdir’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline: no visible global
  function definition for ‘setNames’
barcode_demultiplex,FLAMES.MultiSampleSCPipeline : <anonymous>: no
  visible global function definition for ‘setNames’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘expect_cell_number’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘demultiplexed_fastq’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘barcodes_file’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible binding for
  global variable ‘outdir’
barcode_demultiplex,FLAMES.SingleCellPipeline: no visible global
  function definition for ‘setNames’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘genome_bam’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘threads’
genome_alignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘step’
plot_durations,FLAMES.Pipeline: no visible binding for global variable
  ‘duration’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘j’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_assembly’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘transcriptome_bam’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘minimap2’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘samtools’
read_realignment_raw,FLAMES.Pipeline: no visible binding for global
  variable ‘outdir’
resume_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
run_FLAMES,FLAMES.Pipeline : <anonymous>: no visible global function
  definition for ‘capture.output’
Undefined global functions or variables:
  BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Reads
  Sample Type UMI UMI_count adj.p.value allele allele_count as
  bam_index barcode barcode_rank barcodes_file capture.output
  cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed
  reads demultiplexed_fastq download.file duration everything
  expect_cell_number expr fastq filter_res genome_bam genotype head
  imageX imageY in_tissue input j length_bin max_length min_length
  minimap2 multi-matching reads mutation_index n_reads na.omit name new
  nucleotide outdir output p.value packageVersion pct pos
  read1_with_adapter read_counts ref samtools scale_alpha_continuous
  scale_colour_gradient setNames single match reads starts_with step
  test threads total total reads total_counts tr_length transcript
  transcriptome_assembly transcriptome_bam undemultiplexted reads unzip
  value which_label x y
Consider adding
  importFrom("base", "match", "single")
  importFrom("methods", "as", "new")
  importFrom("stats", "chisq.test", "na.omit", "setNames", "step")
  importFrom("utils", "capture.output", "download.file", "head",
             "packageVersion", "unzip")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... INFO
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking include directives in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
File ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs/FLAMES.so’:
  Found ‘___assert_rtn’, possibly from ‘assert’ (C)
  Found ‘___stderrp’, possibly from ‘stderr’ (C)
  Found ‘___stdoutp’, possibly from ‘stdout’ (C)
  Found ‘_abort’, possibly from ‘abort’ (C)
  Found ‘_exit’, possibly from ‘exit’ (C)

Compiled code should not call entry points which might terminate R nor
write to stdout/stderr instead of to the console, nor use Fortran I/O
nor system RNGs nor [v]sprintf. The detected symbols are linked into
the code but might come from libraries and not actually be called.

See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual.
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                               user system elapsed
plot_isoform_reduced_dim     27.442  0.601  29.832
find_variants                25.456  0.505  25.852
sc_long_multisample_pipeline 17.205  3.998  25.200
MultiSampleSCPipeline        13.128  2.698  30.323
sc_plot_genotype             11.301  0.455  11.752
sc_DTU_analysis               9.664  1.750  12.639
plot_isoform_heatmap          9.688  0.607  10.505
create_sce_from_dir           7.759  2.203  10.216
blaze                         7.659  1.404  15.498
sc_long_pipeline              5.483  1.018   5.687
sc_genotype                   4.064  1.211   4.339
BulkPipeline                  4.525  0.734   5.915
bulk_long_pipeline            3.871  1.087   5.833
create_se_from_dir            3.700  0.890   5.056
resume_FLAMES                 2.863  0.889   9.762
experiment                    2.865  0.528   6.396
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 5 NOTEs
See
  ‘/Users/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’
for details.

Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library’
* installing *source* package ‘FLAMES’ ...
** this is package ‘FLAMES’ version ‘2.3.5’
** using non-staged installation via StagedInstall field
** libs
/bin/sh: rustc: command not found
using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’
using C++17
using SDK: ‘MacOSX11.3.1.sdk’
/bin/sh: rustc: command not found
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppExports.cpp -o RcppExports.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c RcppFunctions.cpp -o RcppFunctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/BamRecord.cpp -o classes/BamRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GFFRecord.cpp -o classes/GFFRecord.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/Isoforms.cpp -o classes/Isoforms.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c classes/junctions.cpp -o classes/junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o
main-functions/pileup_readid.cpp:86:16: warning: unused variable 'end' [-Wunused-variable]
  unsigned int end;
               ^
1 warning generated.
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-junctions.cpp -o tests/test-junctions.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c tests/test-parsing.cpp -o tests/test-parsing.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/cigars.cpp -o utility/cigars.o
clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2   -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
clang -arch x86_64 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/testthat/include' -I/opt/R/x86_64/include    -fPIC  -falign-functions=64 -Wall -g -O2  -c utility/bam.c -o utility/bam.o
clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
Building for x86_64
(cd submodule/minimap2 && make -f Makefile CFLAGS="-falign-functions=64 -Wall -g -O2  -Wno-unused-result" minimap2)
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  main.c -o main.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  kthread.c -o kthread.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  kalloc.c -o kalloc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  misc.c -o misc.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  bseq.c -o bseq.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  sketch.c -o sketch.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  sdust.c -o sdust.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  options.c -o options.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  index.c -o index.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  lchain.c -o lchain.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  align.c -o align.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  hit.c -o hit.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  seed.c -o seed.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  jump.c -o jump.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  map.c -o map.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  format.c -o format.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  pe.c -o pe.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  esterr.c -o esterr.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -DHAVE_KALLOC  splitidx.c -o splitidx.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -DHAVE_KALLOC  ksw2_ll_sse.c -o ksw2_ll_sse.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extz2_sse.c -o ksw2_extz2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_extd2_sse.c -o ksw2_extd2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_exts2_sse.c -o ksw2_exts2_sse41.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extz2_sse.c -o ksw2_extz2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_extd2_sse.c -o ksw2_extd2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse2 -mno-sse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY  ksw2_exts2_sse.c -o ksw2_exts2_sse2.o
cc -c -falign-functions=64 -Wall -g -O2  -Wno-unused-result -msse4.1 -DHAVE_KALLOC -DKSW_CPU_DISPATCH  ksw2_dispatch.c -o ksw2_dispatch.o
ar -csru libminimap2.a kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
cc -falign-functions=64 -Wall -g -O2  -Wno-unused-result main.o -o minimap2 -L. -lminimap2 -lm -lz -lpthread
echo "Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin"
Installing binary to /Users/biocbuild/bbs-3.22-bioc/meat/FLAMES/src/../inst/bin
mkdir -p ../inst/bin
cp submodule/minimap2/minimap2 ../inst/bin/
Cargo not found, skipping oarfish installation.
installing to /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/libs
** R
** data
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
*** copying figures
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.5.1 Patched (2025-09-10 r88807) -- "Great Square Root"
Copyright (C) 2025 The R Foundation for Statistical Computing
Platform: x86_64-apple-darwin20

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> # This file is part of the standard setup for testthat.
> # It is recommended that you do not modify it.
> #
> # Where should you do additional test configuration?
> # Learn more about the roles of various files in:
> # * https://r-pkgs.org/tests.html
> # * https://testthat.r-lib.org/reference/test_package.html#special-files
> 
> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c58bca08/config_file_4764.json 
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c58bca08/config_file_4764.json 
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c58bca08/config_file_4764.json 
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c17360cdf/config_file_4764.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c30f3b931/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c21c92655/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c21c92655/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c408c08aa/musc_rps24_1.fastq
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c408c08aa/musc_rps24_2.fastq
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c408c08aa/musc_rps24_3.fastq
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c408c08aa/musc_rps24_4.fastq
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c18fc5962/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
Skipping TSO trimming...
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c9a6ea95/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:24:36 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:24:38 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%[22:24:48] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[22:24:48] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[22:24:48] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[22:24:48] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[22:24:51] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.

[22:24:51] WARNING: src/learner.cc:553: 
  If you are loading a serialized model (like pickle in Python, RDS in R) generated by
  older XGBoost, please export the model by calling `Booster.save_model` from that version
  first, then load it back in current version. See:

    https://xgboost.readthedocs.io/en/latest/tutorials/saving_model.html

  for more details about differences between saving model and serializing.


  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:25:09 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpjNKYVT/file129c9a6ea95/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Oct 17 22:25:11 2025 ----------
[2m2025-10-18T02:25:11.388574Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:25:11.426074Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c9a6ea95/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:25:11.428568Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:25:11.428980Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:25:11.445161Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:25:11.445269Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:25:11.463307Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:25:11.467169Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:25:11.467308Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116
[2m2025-10-18T02:25:11.467556Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96
[2m2025-10-18T02:25:11.467581Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-10-18T02:25:11.476826Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:25:11.595140Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:25:11.596245Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c9a6ea95/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:25:11.596292Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:25:11.596306Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:25:11.596450Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:25:11.596474Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:25:11.599490Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:25:11.599958Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:25:11.600029Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114
[2m2025-10-18T02:25:11.600042Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95
[2m2025-10-18T02:25:11.600049Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82
[2m2025-10-18T02:25:11.604974Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:25:11.700849Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:25:11.701401Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c9a6ea95/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:25:11.701436Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:25:11.701447Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:25:11.701600Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:25:11.701634Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:25:11.704967Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2025-10-18T02:25:11.705360Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:25:11.705429Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239
[2m2025-10-18T02:25:11.705439Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179
[2m2025-10-18T02:25:11.705447Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143
[2m2025-10-18T02:25:11.710578Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c23fe2894/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:25:15 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample1_align2genome.bam
sample2 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample2_align2genome.bam
sample3 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:25:43 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:26:07 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpjNKYVT/file129c23fe2894/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:26:33 2025 ----------
[2m2025-10-18T02:26:33.767709Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:26:33.772220Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c23fe2894/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:26:33.772418Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:26:33.772485Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:26:33.773951Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:26:33.774062Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:26:33.778186Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:26:33.781097Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 253   │
│ aligned fraction too low        │ 4     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 1     │
│ reads with valid best alignment │ 96    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:26:33.781361Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 116
[2m2025-10-18T02:26:33.781377Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 96
[2m2025-10-18T02:26:33.781385Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-10-18T02:26:33.789336Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:26:33.891363Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:26:33.893540Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c23fe2894/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:26:33.893592Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:26:33.893681Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:26:33.893917Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:26:33.893945Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:26:33.898228Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:26:33.898531Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 251   │
│ aligned fraction too low        │ 5     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 2     │
│ reads with valid best alignment │ 95    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:26:33.898582Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 114
[2m2025-10-18T02:26:33.898613Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 95
[2m2025-10-18T02:26:33.898619Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 82
[2m2025-10-18T02:26:33.903884Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:26:34.016766Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:26:34.017515Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c23fe2894/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:26:34.017564Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:26:34.017586Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:26:34.017714Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:26:34.017738Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:26:34.023019Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 2 unmapped read records.
[2m2025-10-18T02:26:34.023606Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 398   │
│ aligned fraction too low        │ 12    │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 5     │
│ reads with valid best alignment │ 179   │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:26:34.023690Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 239
[2m2025-10-18T02:26:34.023703Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 179
[2m2025-10-18T02:26:34.023710Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 143
[2m2025-10-18T02:26:34.029368Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c31853e6b/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:26:35 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:26:36 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:26:58 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpjNKYVT/file129c31853e6b/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:26:59 2025 ----------
22:26:59 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/RtmpjNKYVT/file129c31853e6b/sample3_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c31853e6b/sample2_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c31853e6b/sample1_realign2transcript.bam'] /tmp/RtmpjNKYVT/file129c31853e6b/transcript_assembly.fa.fai 5 0.4 0.4
Testing: run_FLAMES(BulkPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c23a90153/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:27:02 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c23a90153/sample1_align2genome.bam
sample2 ->/tmp/RtmpjNKYVT/file129c23a90153/sample2_align2genome.bam
sample3 ->/tmp/RtmpjNKYVT/file129c23a90153/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:27:25 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |=======================                                               |  33%
  |                                                                            
  |===============================================                       |  67%
  |                                                                            
  |======================================================================| 100%

Detected 4 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:27:47 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c23a90153/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpjNKYVT/file129c23a90153/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpjNKYVT/file129c23a90153/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:28:09 2025 ----------
22:28:09 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c594d7272/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:28:13 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpjNKYVT/file129c594d7272/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpjNKYVT/file129c594d7272/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpjNKYVT/file129c594d7272/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:28:14 2025 -------------
Inputs:  ['/tmp/RtmpjNKYVT/file129c23a90153/sample3_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c23a90153/sample2_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c23a90153/sample1_realign2transcript.bam'] /tmp/RtmpjNKYVT/file129c23a90153/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 375, 'not_enough_coverage': 16, 'unmapped': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:28:15 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpjNKYVT/file129c594d7272/sample1_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample2 -> /tmp/RtmpjNKYVT/file129c594d7272/sample2_realign2transcript.bam
Skipped sorting BAM files.

Realigning sample sample3 -> /tmp/RtmpjNKYVT/file129c594d7272/sample3_realign2transcript.bam
Skipped sorting BAM files.

-- Running step: transcript_quantification @ Fri Oct 17 22:28:17 2025 ----------
[2m2025-10-18T02:28:18.418505Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:28:18.734480Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c594d7272/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:28:18.745481Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:28:18.745684Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:28:18.792851Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:28:18.792938Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:28:18.831646Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:28:18.870129Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:28:18.912717Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-10-18T02:28:18.912805Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-10-18T02:28:18.912821Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-10-18T02:28:18.919705Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:28:19.368840Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:28:19.369636Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c594d7272/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:28:19.369688Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:28:19.369719Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:28:19.370079Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:28:19.370124Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:28:19.405014Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:28:19.419415Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:28:19.419505Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-10-18T02:28:19.419515Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-10-18T02:28:19.419521Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-10-18T02:28:19.435021Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:28:19.616832Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:28:19.618778Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c594d7272/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:28:19.618909Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:28:19.618948Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:28:19.619095Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:28:19.619111Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:28:19.627868Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:28:19.628814Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:28:19.628880Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-10-18T02:28:19.628890Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-10-18T02:28:19.628899Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-10-18T02:28:19.635093Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c266c466b/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:28:20 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c266c466b/sample1_align2genome.bam
sample2 ->/tmp/RtmpjNKYVT/file129c266c466b/sample2_align2genome.bam
sample3 ->/tmp/RtmpjNKYVT/file129c266c466b/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:28:43 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:28:44 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c266c466b/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpjNKYVT/file129c266c466b/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpjNKYVT/file129c266c466b/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:29:11 2025 ----------
[2m2025-10-18T02:29:11.853530Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:29:11.859920Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c266c466b/sample1_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:29:11.860189Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:29:11.860269Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:29:11.862185Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:29:11.862220Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:29:11.871590Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:29:11.873970Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 707   │
│ aligned fraction too low        │ 2     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 98    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:29:11.874240Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 125
[2m2025-10-18T02:29:11.874260Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 98
[2m2025-10-18T02:29:11.874269Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 86
[2m2025-10-18T02:29:11.879192Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:29:12.021473Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:29:12.025358Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c266c466b/sample2_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:29:12.025415Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:29:12.025428Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:29:12.025856Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:29:12.025899Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:29:12.034194Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:29:12.037080Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 701   │
│ aligned fraction too low        │ 3     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 97    │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:29:12.037226Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 136
[2m2025-10-18T02:29:12.037260Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 97
[2m2025-10-18T02:29:12.037272Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 79
[2m2025-10-18T02:29:12.044726Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
[2m2025-10-18T02:29:12.123870Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:29:12.124615Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c266c466b/sample3_realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:29:12.124659Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:29:12.124674Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:29:12.124925Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:29:12.124950Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:29:12.131165Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m the alignment file contained 0 unmapped read records.
[2m2025-10-18T02:29:12.131697Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m 
discard_table: 
╭─────────────────────────────────┬───────╮
│ reason                          │ count │
├─────────────────────────────────┼───────┤
│ too far from 5' end             │ 0     │
│ too far from 3' end             │ 0     │
│ score too low                   │ 1060  │
│ aligned fraction too low        │ 6     │
│ aligned length too short        │ 0     │
│ inconsistent orientation        │ 0     │
│ supplementary alignment         │ 0     │
│ reads with valid best alignment │ 187   │
╰─────────────────────────────────┴───────╯

[2m2025-10-18T02:29:12.131784Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m Total number of alignment records : 272
[2m2025-10-18T02:29:12.131795Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of aligned reads : 187
[2m2025-10-18T02:29:12.131802Z[0m [32m INFO[0m [2moarfish::bulk[0m[2m:[0m number of unique alignments : 140
[2m2025-10-18T02:29:12.136009Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m oarfish completed successfully.
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c3d20bfab/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:29:13 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample sample1 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample2 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample sample3 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:29:14 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:29:15 2025 -------------------
Realigning sample sample1 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample1_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample2 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample2_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample sample3 -> /tmp/RtmpjNKYVT/file129c3d20bfab/sample3_realign2transcript.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:29:16 2025 ----------
22:29:16 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Testing: run_FLAMES(BulkPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c1f8dde0f/config_file_4764.json 
Configured steps: 
	genome_alignment: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: genome_alignment @ Fri Oct 17 22:29:17 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample1_align2genome.bam
sample2 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample2_align2genome.bam
sample3 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample3_align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:29:40 2025 -------------
Inputs:  ['/tmp/RtmpjNKYVT/file129c3d20bfab/sample3_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c3d20bfab/sample2_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c3d20bfab/sample1_realign2transcript.bam'] /tmp/RtmpjNKYVT/file129c3d20bfab/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:29:41 2025 -------------------
Realignment complete for the following samples:
sample1 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample1_realign2transcript.bam
sample2 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample2_realign2transcript.bam
sample3 ->/tmp/RtmpjNKYVT/file129c1f8dde0f/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:30:09 2025 ----------
22:30:09 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
Inputs:  ['/tmp/RtmpjNKYVT/file129c1f8dde0f/sample3_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c1f8dde0f/sample2_realign2transcript.bam', '/tmp/RtmpjNKYVT/file129c1f8dde0f/sample1_realign2transcript.bam'] /tmp/RtmpjNKYVT/file129c1f8dde0f/transcript_assembly.fa.fai 5 0.4 0.4
	Counter({'counted_reads': 391, 'not_enough_coverage': 2})
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129cd3e59c9/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:30:10 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129cd3e59c9/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:30:11 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129cd3e59c9/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129cd3e59c9/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:30:11 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:30:24 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129cd3e59c9/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129cd3e59c9/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpjNKYVT/file129cd3e59c9/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129cd3e59c9/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Oct 17 22:30:24 2025 ----------
[2m2025-10-18T02:30:24.959114Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:30:24.997806Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129cd3e59c9/realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:30:24.999851Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:30:25.000120Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:30:25.003635Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:30:25.003692Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:30:26.383631Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c10791fd7/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:30:27 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c10791fd7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:30:28 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c10791fd7/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c10791fd7/align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:31:00 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:31:12 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c10791fd7/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c10791fd7/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c10791fd7/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c10791fd7/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:31:39 2025 ----------
[2m2025-10-18T02:31:40.007436Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:31:40.019180Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c10791fd7/realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:31:40.019608Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:31:40.019661Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:31:40.022694Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:31:40.022815Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:31:40.052567Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c30e52b1d/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:31:40 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c30e52b1d/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:31:41 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c30e52b1d/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c30e52b1d/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:31:41 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:31:54 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c30e52b1d/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c30e52b1d/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpjNKYVT/file129c30e52b1d/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c30e52b1d/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:31:54 2025 ----------
22:31:54 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c4c522f0c/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:31:56 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c4c522f0c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:31:56 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c4c522f0c/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c4c522f0c/align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:32:25 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---
Detected 2 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:32:36 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c4c522f0c/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c4c522f0c/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c4c522f0c/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c4c522f0c/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:33:11 2025 ----------
22:33:11 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
	Counter({'counted_reads': 354, 'not_enough_coverage': 12, 'unmapped': 6})
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c3fcd9464/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:33:15 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c3fcd9464/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:33:15 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c3fcd9464/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c3fcd9464/align2genome.bam
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:33:16 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:33:17 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c3fcd9464/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c3fcd9464/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpjNKYVT/file129c3fcd9464/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c3fcd9464/realign2transcript.bam
Sorting BAM files by 8 with CB threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
-- Running step: transcript_quantification @ Fri Oct 17 22:33:17 2025 ----------
[2m2025-10-18T02:33:18.053594Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:33:18.066919Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c3fcd9464/realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:33:18.066969Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:33:18.067212Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:33:18.119701Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:33:18.120034Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:33:18.341470Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c39fad431/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:33:20 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c39fad431/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:33:20 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c39fad431/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c39fad431/align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:33:55 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:33:55 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c39fad431/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c39fad431/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c39fad431/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c39fad431/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:34:20 2025 ----------
[2m2025-10-18T02:34:21.045269Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:34:21.060437Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c39fad431/realign2transcript.bam, contains 10 reference sequences.
[2m2025-10-18T02:34:21.060552Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:34:21.060590Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:34:21.063040Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:34:21.063104Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 10 transcripts.
[2m2025-10-18T02:34:21.094743Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c205b77de/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:34:23 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c205b77de/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:34:23 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c205b77de/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c205b77de/align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

Indexing bam files
-- Running step: isoform_identification @ Fri Oct 17 22:34:24 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:34:24 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c205b77de/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c205b77de/matched_reads_dedup.fastq.gz
	files not found
Realigning sample /tmp/RtmpjNKYVT/file129c205b77de/matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c205b77de/realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 8 threads...

[bam_sort_core] merging from 0 files and 8 in-memory blocks...
Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:34:25 2025 ----------
22:34:25 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(SingleCellPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c527f48b8/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: FALSE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:34:26 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 8
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c527f48b8/bc_allow.tsv
Number of known barcodes: 143
Processing file: /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
-- Running step: genome_alignment @ Fri Oct 17 22:34:27 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c527f48b8/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c527f48b8/align2genome.bam
-- Running step: isoform_identification @ Fri Oct 17 22:34:52 2025 -------------
	Counter({'counted_reads': 368, 'unmapped': 4})
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:34:52 2025 -------------------
Checking for fastq file(s) /Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/extdata/fastq/musc_rps24.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c527f48b8/matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c527f48b8/matched_reads_dedup.fastq.gz
	files not found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c527f48b8/matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c527f48b8/realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:35:15 2025 ----------
22:35:15 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	realign2transcript.bam
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c7e294af2/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:35:17 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7e294af2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7e294af2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7e294af2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7e294af2/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:35:19 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample1_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample2_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample3_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Oct 17 22:35:21 2025 ----------------
22:35:21 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c7e294af2/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c7e294af2/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c7e294af2/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c7e294af2/sample3_align2genome.bam'
	Counter({'counted_reads': 368, 'unmapped': 4})
parsing /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  3.67gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  3.66gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
2025-10-17 22:35:25.939 R[4764:573101443] XType: com.apple.fonts is not accessible.
2025-10-17 22:35:25.939 R[4764:573101443] XType: XTFontStaticRegistry is enabled.
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 55768.79Read/s]
parsing /tmp/RtmpjNKYVT/file129c7e294af2/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 35.03gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 742039.49Read/s]
parsing /tmp/RtmpjNKYVT/file129c7e294af2/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 32.68gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 101588.48Read/s]
parsing /tmp/RtmpjNKYVT/file129c7e294af2/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.58gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 460750.51Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:35:28 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:35:56 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7e294af2/fastq, /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7e294af2/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c7e294af2/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c7e294af2/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Oct 17 22:35:57 2025 ----------
[2m2025-10-18T02:35:58.069923Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:35:58.073378Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c7e294af2/sampleA_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:35:58.073435Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:35:58.073456Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:35:58.074481Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:35:58.074521Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:35:58.105597Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-10-18T02:35:58.509398Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:35:58.510042Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c7e294af2/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:35:58.510107Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:35:58.510144Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:35:58.510292Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:35:58.510338Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:35:58.913108Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:35:58.913773Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c7e294af2/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:35:58.913823Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:35:58.913841Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:35:58.913986Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:35:58.914010Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:35:59.361180Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:35:59.361858Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c7e294af2/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:35:59.361902Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:35:59.361919Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:35:59.362048Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:35:59.362067Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c6bd545/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:36:00 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c6bd545/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c6bd545/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c6bd545/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c6bd545/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:36:03 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c6bd545/sampleA_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sampleA_align2genome.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample1_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample1_align2genome.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample2_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample2_align2genome.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample3_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Oct 17 22:36:34 2025 ----------------
22:36:34 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c6bd545/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c6bd545/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c6bd545/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c6bd545/sample3_align2genome.bam'
parsing /tmp/RtmpjNKYVT/file129c6bd545/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 12.22gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 178544.84Read/s]
parsing /tmp/RtmpjNKYVT/file129c6bd545/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 33.62gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 338163.05Read/s]
parsing /tmp/RtmpjNKYVT/file129c6bd545/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 34.36gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 748127.85Read/s]
parsing /tmp/RtmpjNKYVT/file129c6bd545/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 26.28gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 309478.78Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:36:35 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:37:00 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c6bd545/fastq, /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c6bd545/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c6bd545/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c6bd545/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c6bd545/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c6bd545/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sampleA_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample1_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample2_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c6bd545/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c6bd545/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:37:30 2025 ----------
[2m2025-10-18T02:37:30.552649Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:37:30.560613Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c6bd545/sampleA_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:37:30.560949Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:37:30.560972Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:37:30.564242Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:37:30.564360Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:37:30.594377Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-10-18T02:37:31.111946Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:37:31.112707Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c6bd545/sample1_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:37:31.112745Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:37:31.112757Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:37:31.112869Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:37:31.112889Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:37:31.618447Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:37:31.619323Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c6bd545/sample2_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:37:31.619371Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:37:31.619384Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:37:31.619527Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:37:31.619548Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
[2m2025-10-18T02:37:32.087311Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:37:32.088155Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c6bd545/sample3_realign2transcript.bam, contains 5 reference sequences.
[2m2025-10-18T02:37:32.088200Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:37:32.088212Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:37:32.088357Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:37:32.088384Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 5 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c20c3f64c/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:37:33 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c20c3f64c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c20c3f64c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c20c3f64c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c20c3f64c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:37:35 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Oct 17 22:37:37 2025 ----------------
22:37:37 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c20c3f64c/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c20c3f64c/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c20c3f64c/sample3_align2genome.bam'
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 17.87gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 348283.12Read/s]
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 16.57gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1627718.10Read/s]
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 44.25gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1460208.88Read/s]
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 27.66gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 116490.32Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:37:39 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:38:14 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c20c3f64c/fastq, /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:38:15 2025 ----------
22:38:15 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c20c3f64c/sample3_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c20c3f64c/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c20c3f64c/sample2_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_realign2transcript.bam...
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
parsing /tmp/RtmpjNKYVT/file129c20c3f64c/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c20c3f64c/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=TRUE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c7aa60e74/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:38:18 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7aa60e74/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7aa60e74/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7aa60e74/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c7aa60e74/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:38:20 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_align2genome.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_align2genome.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_align2genome.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Oct 17 22:38:51 2025 ----------------
22:38:51 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_align2genome.bam'
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 13.90gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 268438.89Read/s]
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 35.98gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 943303.35Read/s]
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 37.80gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 94589.87Read/s]
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 10.89gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 180297.81Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:38:53 2025 -------------
Unzipping annotation file for bambu
--- Start generating read class files ---

  |                                                                            
  |                                                                      |   0%
  |                                                                            
  |==================                                                    |  25%
  |                                                                            
  |===================================                                   |  50%
  |                                                                            
  |====================================================                  |  75%
  |                                                                            
  |======================================================================| 100%

Detected 6 warnings across the samples during read class construction. Access warnings with metadata(bambuOutput)$warnings
--- Start extending annotations ---
WARNING - Less than 50 TRUE or FALSE read classes for NDR precision stabilization.
NDR will be approximated as: (1 - Transcript Model Prediction Score)
For your combination of sample and reference annotations we recommend an NDR of 0. You are currently using an NDR threshold of 0.5. A higher NDR is suited for samples where the reference annotations are poor and more novel transcripts are expected,whereas a lower NDR is suited for samples with already high quality annotations
--- Start isoform quantification ---
--- Finished running Bambu ---
-- Running step: read_realignment @ Fri Oct 17 22:39:20 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7aa60e74/fastq, /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c7aa60e74/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:39:45 2025 ----------
22:39:45 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample3_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c7aa60e74/sample3_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c7aa60e74/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample2_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample2_realign2transcript.bamdone
	Counter({'counted_reads': 168, 'not_enough_coverage': 6, 'unmapped': 2})
	Counter({'counted_reads': 347, 'not_enough_coverage': 9, 'unmapped': 2})
	Counter({'counted_reads': 92, 'not_enough_coverage': 3})
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c7aa60e74/sample2_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample1_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c7aa60e74/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c7aa60e74/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c48152a0c/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:39:49 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c48152a0c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c48152a0c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c48152a0c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c48152a0c/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:39:51 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample1_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample1_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample2_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample2_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample3_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample3_align2genome.bam
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Oct 17 22:39:53 2025 ----------------
22:39:53 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c48152a0c/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c48152a0c/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c48152a0c/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c48152a0c/sample3_align2genome.bam'
	Counter({'counted_reads': 89, 'not_enough_coverage': 2})
parsing /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 15.30gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 328779.36Read/s]
parsing /tmp/RtmpjNKYVT/file129c48152a0c/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 33.94gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1155328.34Read/s]
parsing /tmp/RtmpjNKYVT/file129c48152a0c/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 37.61gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 717956.86Read/s]
parsing /tmp/RtmpjNKYVT/file129c48152a0c/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.14gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 562178.85Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:39:54 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:39:55 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c48152a0c/fastq, /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c48152a0c/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample1_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample2_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

Realigning sample /tmp/RtmpjNKYVT/file129c48152a0c/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c48152a0c/sample3_realign2transcript.bam
Sorting BAM files by 1 with CB threads...

-- Running step: transcript_quantification @ Fri Oct 17 22:39:57 2025 ----------
[2m2025-10-18T02:39:57.844998Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:39:57.848022Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c48152a0c/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:39:57.848134Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:39:57.848157Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:39:57.849463Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:39:57.849528Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:39:57.874384Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-10-18T02:39:58.565157Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:39:58.565964Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c48152a0c/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:39:58.566004Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:39:58.566022Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:39:58.566171Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:39:58.566189Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:39:59.355012Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:39:59.355632Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c48152a0c/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:39:59.355675Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:39:59.355689Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:39:59.355834Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:39:59.355852Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:40:00.161326Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:40:00.162076Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c48152a0c/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:40:00.162129Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:40:00.162148Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:40:00.162339Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:40:00.162371Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=TRUE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c3a6e9cb7/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:40:01 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c3a6e9cb7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c3a6e9cb7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c3a6e9cb7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c3a6e9cb7/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:40:05 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_align2genome.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_align2genome.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_align2genome.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Oct 17 22:40:32 2025 ----------------
22:40:32 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_align2genome.bam'
parsing /tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 16.10gene_group/s]
/Library/Frameworks/R.framework/Versions/4.5-x86_64/Resources/library/FLAMES/python/count_gene.py:705: RuntimeWarning: More than 20 figures have been opened. Figures created through the pyplot interface (`matplotlib.pyplot.figure`) are retained until explicitly closed and may consume too much memory. (To control this warning, see the rcParam `figure.max_open_warning`). Consider using `matplotlib.pyplot.close()`.
  plt.figure(figsize=(8, 6))
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 305440.14Read/s]
parsing /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 36.15gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1096378.08Read/s]
parsing /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 35.16gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 582348.11Read/s]
parsing /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 28.96gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 607517.96Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:40:33 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:40:34 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq, /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:40:58 2025 ----------
[2m2025-10-18T02:40:58.461911Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:40:58.467721Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c3a6e9cb7/sampleA_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:40:58.467995Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:40:58.468048Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:40:58.469875Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:40:58.470007Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:40:58.505462Z[0m [32m INFO[0m [2moarfish::single_cell[0m[2m:[0m Processed 100 cells.
[2m2025-10-18T02:40:59.534455Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:40:59.535501Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample1_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:40:59.535588Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:40:59.535626Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:40:59.535842Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:40:59.535876Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:41:00.446902Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:41:00.447864Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample2_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:41:00.447932Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:41:00.447962Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:41:00.448137Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:41:00.448160Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
[2m2025-10-18T02:41:01.247801Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m setting user-provided filter parameters.
[2m2025-10-18T02:41:01.248488Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m read header from BAM file /tmp/RtmpjNKYVT/file129c3a6e9cb7/sample3_realign2transcript.bam, contains 14 reference sequences.
[2m2025-10-18T02:41:01.248535Z[0m [32m INFO[0m [2moarfish::alignment_parser[0m[2m:[0m saw minimap2 as a program in the header; proceeding.
[2m2025-10-18T02:41:01.248552Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m calculating seqcol digest
[2m2025-10-18T02:41:01.248757Z[0m [32m INFO[0m [2moarfish::util::digest_utils[0m[2m:[0m done calculating seqcol digest
[2m2025-10-18T02:41:01.248784Z[0m [32m INFO[0m [2moarfish[0m[2m:[0m parsed reference information for 14 transcripts.
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c25ecaa5b/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:41:03 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c25ecaa5b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c25ecaa5b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c25ecaa5b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c25ecaa5b/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:41:05 2025 -------------------
Creating junction bed file from GFF3 annotation.
Aligning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Aligning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_matched_reads.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_align2genome.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: gene_quantification @ Fri Oct 17 22:41:07 2025 ----------------
22:41:07 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_align2genome.bam'
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 18.93gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 272300.82Read/s]
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 36.04gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1006021.30Read/s]
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 37.13gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1090789.56Read/s]
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  5.18gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00,  5.17gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 634577.58Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:41:09 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:41:09 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq, /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_matched_reads_dedup.fastq.gz
	files found
Realigning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
Realigning sample /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_matched_reads_dedup.fastq.gz -> /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_realign2transcript.bam
Your fastq file appears to have tags, but you did not provide the -y option to minimap2 to include the tags in the output.
Sorting BAM files by genome coordinates with 1 threads...

Indexing bam files
-- Running step: transcript_quantification @ Fri Oct 17 22:41:10 2025 ----------
22:41:10 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c25ecaa5b/sample3_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c25ecaa5b/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c25ecaa5b/sample2_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c25ecaa5b/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
Testing: run_FLAMES(MultiSampleSCPipeline, bambu=FALSE, oarfish=FALSE, controller=none)
Writing configuration parameters to:  /tmp/RtmpjNKYVT/file129c35f18e11/config_file_4764.json 
Configured steps: 
	barcode_demultiplex: TRUE
	genome_alignment: TRUE
	gene_quantification: TRUE
	isoform_identification: TRUE
	read_realignment: TRUE
	transcript_quantification: TRUE
samtools not found, will use Rsamtools package instead
-- Running step: barcode_demultiplex @ Fri Oct 17 22:41:15 2025 ----------------
Using flexiplex for barcode demultiplexing.
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c35f18e11/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample1.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample2.fq.gz
Searching for barcodes...
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 393
Number of reads where at least one barcode was found: 368
Number of reads with exactly one barcode match: 364
Number of chimera reads: 1
All done!
Reads	Barcodes
10	2
9	2
8	5
7	4
6	3
5	7
4	14
3	14
2	29
1	57
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c35f18e11/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample1.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 92
Number of reads with exactly one barcode match: 91
Number of chimera reads: 1
All done!
Reads	Barcodes
4	1
3	9
2	9
1	44
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c35f18e11/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample2.fq.gz
Searching for barcodes...
Number of reads processed: 100
Number of reads where at least one barcode was found: 95
Number of reads with exactly one barcode match: 94
Number of chimera reads: 0
All done!
Reads	Barcodes
4	2
3	3
2	16
1	47
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpjNKYVT/file129c35f18e11/bc_allow.tsv
Number of known barcodes: 143
Processing file: /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample3.fq.gz
Searching for barcodes...
Number of reads processed: 193
Number of reads where at least one barcode was found: 181
Number of reads with exactly one barcode match: 179
Number of chimera reads: 0
All done!
Reads	Barcodes
7	1
6	1
5	1
4	7
3	10
2	27
1	53
-- Running step: genome_alignment @ Fri Oct 17 22:41:17 2025 -------------------
Creating junction bed file from GFF3 annotation.
Alignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_align2genome.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample1_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample1_align2genome.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample2_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample2_align2genome.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample3_matched_reads.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample3_align2genome.bam
-- Running step: gene_quantification @ Fri Oct 17 22:41:40 2025 ----------------
22:41:40 Fri Oct 17 2025 quantify genes 
Using BAM(s): '/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c35f18e11/sample1_align2genome.bam',
'/tmp/RtmpjNKYVT/file129c35f18e11/sample2_align2genome.bam', and
'/tmp/RtmpjNKYVT/file129c35f18e11/sample3_align2genome.bam'
	Counter({'counted_reads': 176})
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 91})
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sampleA_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 15.53gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 300761.82Read/s]
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample1_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 37.02gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 1525423.33Read/s]
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample2_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 32.81gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 946282.83Read/s]
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample3_align2genome.bam...
Assigning reads to genes...

Processed:   0%|          | 0/1 [00:00<?, ?gene_group/s]
Processed: 100%|██████████| 1/1 [00:00<00:00, 24.27gene_group/s]
Writing the gene count matrix ...
Plotting the saturation curve ...
Generating deduplicated fastq file ...

Processed: 0Read [00:00, ?Read/s]
Processed: 2500.0Read [00:00, 617245.11Read/s]
-- Running step: isoform_identification @ Fri Oct 17 22:41:42 2025 -------------
#### Read gene annotations
	Removed similar transcripts in gene annotation: Counter()
#### find isoforms
chr14
-- Running step: read_realignment @ Fri Oct 17 22:41:42 2025 -------------------
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c35f18e11/fastq, /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample1.fq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample2.fq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/fastq/sample3.fq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c35f18e11/sampleA_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample1_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample2_matched_reads.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample3_matched_reads.fastq.gz
	files found
Checking for fastq file(s) /tmp/RtmpjNKYVT/file129c35f18e11/sampleA_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample1_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample2_matched_reads_dedup.fastq.gz, /tmp/RtmpjNKYVT/file129c35f18e11/sample3_matched_reads_dedup.fastq.gz
	files found
Realignment complete for the following samples:
/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample1_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample1_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample2_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample2_realign2transcript.bam
/tmp/RtmpjNKYVT/file129c35f18e11/sample3_matched_reads_dedup.fastq.gz ->/tmp/RtmpjNKYVT/file129c35f18e11/sample3_realign2transcript.bam
-- Running step: transcript_quantification @ Fri Oct 17 22:42:05 2025 ----------
22:42:05 Fri Oct 17 2025 quantify transcripts 
Found realignment file(s): 	sample1_realign2transcript.bam
	sample2_realign2transcript.bam
	sample3_realign2transcript.bam
	sampleA_realign2transcript.bam
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample3_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample3_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c35f18e11/sample3_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sampleA_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sampleA_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c35f18e11/sampleA_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample2_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample2_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c35f18e11/sample2_realign2transcript.bamdone
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample1_realign2transcript.bam...
parsing /tmp/RtmpjNKYVT/file129c35f18e11/sample1_realign2transcript.bamdone
wrt_tr_to_csv for/tmp/RtmpjNKYVT/file129c35f18e11/sample1_realign2transcript.bamdone
annotate_full_splice_match_all_sample...
[ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ]

[ FAIL 0 | WARN 183 | SKIP 0 | PASS 59 ]
	Counter({'counted_reads': 176})
	Counter({'counted_reads': 358})
	Counter({'counted_reads': 95})
	Counter({'counted_reads': 91})
> 
> proc.time()
    user   system  elapsed 
 834.252   80.875 1078.332 
/Users/biocbuild/.pyenv/versions/3.11.9/lib/python3.11/multiprocessing/resource_tracker.py:254: UserWarning: resource_tracker: There appear to be 1 leaked semaphore objects to clean up at shutdown
  warnings.warn('resource_tracker: There appear to be %d '

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

name	user	system	elapsed
BulkPipeline	4.525	0.734	5.915
MultiSampleSCPipeline	13.128	2.698	30.323
SingleCellPipeline	3.478	0.367	4.393
add_gene_counts	0.214	0.005	0.284
annotation_to_fasta	0.144	0.005	0.182
blaze	7.659	1.404	15.498
bulk_long_pipeline	3.871	1.087	5.833
combine_sce	0.970	0.096	1.096
config-set	0.307	0.242	0.614
config	0.395	0.405	0.857
controllers-set	0.487	0.097	0.672
controllers	0.326	0.259	1.212
convolution_filter	0.000	0.001	0.003
create_config	0.009	0.003	0.015
create_sce_from_dir	7.759	2.203	10.216
create_se_from_dir	3.700	0.890	5.056
cutadapt	0.180	0.087	0.384
example_pipeline	0.439	0.050	0.538
experiment	2.865	0.528	6.396
filter_annotation	0.061	0.006	0.068
filter_coverage	1.444	0.314	1.962
find_barcode	1.839	0.300	2.349
find_bin	0.007	0.009	0.028
find_variants	25.456	0.505	25.852
get_coverage	1.518	0.511	2.205
index_genome	0.314	0.206	0.581
mutation_positions	1.642	0.050	1.713
plot_coverage	3.622	0.401	4.220
plot_demultiplex	3.149	0.528	4.435
plot_demultiplex_raw	1.763	0.093	2.036
plot_durations	2.927	0.511	3.851
plot_isoform_heatmap	9.688	0.607	10.505
plot_isoform_reduced_dim	27.442	0.601	29.832
plot_isoforms	2.843	0.047	3.499
resume_FLAMES	2.863	0.889	9.762
run_FLAMES	2.577	0.483	3.929
run_step	1.168	0.292	2.734
sc_DTU_analysis	9.664	1.750	12.639
sc_gene_entropy	1.389	0.068	1.796
sc_genotype	4.064	1.211	4.339
sc_impute_transcript	0.849	0.019	0.882
sc_long_multisample_pipeline	17.205	3.998	25.200
sc_long_pipeline	5.483	1.018	5.687
sc_mutations	3.193	0.492	3.451
sc_plot_genotype	11.301	0.455	11.752
show-FLAMESPipeline	0.272	0.066	1.622
steps-set	0.409	0.069	0.930
steps	0.201	0.104	2.758
weight_transcripts	0.032	0.055	0.105