Back to Multiple platform build/check report for BioC 3.21: simplified long |
|
This page was generated on 2025-10-16 11:38 -0400 (Thu, 16 Oct 2025).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) | x86_64 | 4.5.1 (2025-06-13) -- "Great Square Root" | 4833 |
merida1 | macOS 12.7.6 Monterey | x86_64 | 4.5.1 RC (2025-06-05 r88288) -- "Great Square Root" | 4614 |
kjohnson1 | macOS 13.7.5 Ventura | arm64 | 4.5.1 Patched (2025-06-14 r88325) -- "Great Square Root" | 4555 |
kunpeng2 | Linux (openEuler 24.03 LTS) | aarch64 | R Under development (unstable) (2025-02-19 r87757) -- "Unsuffered Consequences" | 4586 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 735/2341 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 2.2.0 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 24.04.3 LTS) / x86_64 | OK | OK | OK | ![]() | ||||||||
merida1 | macOS 12.7.6 Monterey / x86_64 | OK | OK | OK | OK | ![]() | ||||||||
kjohnson1 | macOS 13.7.5 Ventura / arm64 | OK | OK | OK | OK | ![]() | ||||||||
kunpeng2 | Linux (openEuler 24.03 LTS) / aarch64 | OK | OK | ERROR | ||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 2.2.0 |
Command: /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings FLAMES_2.2.0.tar.gz |
StartedAt: 2025-10-15 23:16:37 -0400 (Wed, 15 Oct 2025) |
EndedAt: 2025-10-15 23:27:30 -0400 (Wed, 15 Oct 2025) |
EllapsedTime: 652.0 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.21-bioc/R/site-library --timings FLAMES_2.2.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck’ * using R version 4.5.1 (2025-06-13) * using platform: x86_64-pc-linux-gnu * R was compiled by gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0 GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0 * running under: Ubuntu 24.04.3 LTS * using session charset: UTF-8 * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘2.2.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... INFO Imports includes 46 non-default packages. Importing from so many packages makes the package vulnerable to any of them becoming unavailable. Move as many as possible to Suggests and use conditionally. * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’ * checking C++ specification ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE addRowRanges: no visible global function definition for ‘head’ chisq_test_by_gene: no visible global function definition for ‘chisq.test’ create_spe: no visible binding for global variable ‘barcode’ create_spe: no visible binding for global variable ‘in_tissue’ filter_coverage: no visible global function definition for ‘starts_with’ filter_coverage: no visible binding for global variable ‘filter_res’ find_barcode: no visible binding for global variable ‘Sample’ find_barcode: no visible binding for global variable ‘Outfile’ find_variants_grange: no visible binding for global variable ‘which_label’ find_variants_grange: no visible binding for global variable ‘nucleotide’ find_variants_grange: no visible binding for global variable ‘pos’ find_variants_grange: no visible binding for global variable ‘count’ find_variants_grange: no visible binding for global variable ‘counts_no_ins’ find_variants_grange: no visible binding for global variable ‘ref’ generate_sc_sce: no visible binding for global variable ‘FSM_match’ get_coverage: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘Freq’ homopolymer_pct : <anonymous>: no visible binding for global variable ‘pct’ plot_coverage: no visible binding for global variable ‘tr_length’ plot_coverage: no visible binding for global variable ‘read_counts’ plot_coverage: no visible binding for global variable ‘total_counts’ plot_coverage: no visible binding for global variable ‘cumpct’ plot_coverage: no visible binding for global variable ‘length_bin’ plot_coverage: no visible binding for global variable ‘min_length’ plot_coverage: no visible binding for global variable ‘max_length’ plot_coverage: no visible global function definition for ‘head’ plot_coverage: no visible binding for global variable ‘transcript’ plot_demultiplex: no visible binding for global variable ‘CellBarcode’ plot_demultiplex: no visible binding for global variable ‘Sample’ plot_demultiplex: no visible binding for global variable ‘UMI’ plot_demultiplex: no visible binding for global variable ‘UMI_count’ plot_demultiplex: no visible binding for global variable ‘barcode_rank’ plot_demultiplex: no visible binding for global variable ‘FlankEditDist’ plot_demultiplex: no visible binding for global variable ‘n_reads’ plot_demultiplex: no visible binding for global variable ‘BarcodeEditDist’ plot_demultiplex: no visible binding for global variable ‘total reads’ plot_demultiplex: no visible binding for global variable ‘demultiplexed reads’ plot_demultiplex: no visible binding for global variable ‘single match reads’ plot_demultiplex: no visible binding for global variable ‘undemultiplexted reads’ plot_demultiplex: no visible binding for global variable ‘multi-matching reads’ plot_demultiplex: no visible binding for global variable ‘Type’ plot_demultiplex: no visible binding for global variable ‘Reads’ plot_demultiplex: no visible binding for global variable ‘input’ plot_demultiplex: no visible binding for global variable ‘output’ plot_demultiplex: no visible binding for global variable ‘read1_with_adapter’ plot_demultiplex: no visible binding for global variable ‘Count’ plot_flagstat: no visible global function definition for ‘everything’ plot_flagstat: no visible binding for global variable ‘name’ plot_flagstat: no visible binding for global variable ‘value’ plot_isoform_reduced_dim: no visible binding for global variable ‘x’ plot_isoform_reduced_dim: no visible binding for global variable ‘y’ plot_isoform_reduced_dim: no visible binding for global variable ‘expr’ plot_spatial: no visible binding for global variable ‘imageX’ plot_spatial: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘imageX’ plot_spatial_feature: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘x’ plot_spatial_feature: no visible binding for global variable ‘y’ plot_spatial_feature: no visible global function definition for ‘scale_alpha_continuous’ plot_spatial_feature: no visible global function definition for ‘scale_colour_gradient’ plot_spatial_isoform: no visible global function definition for ‘head’ plot_spatial_pie: no visible global function definition for ‘head’ plot_spatial_pie: no visible binding for global variable ‘imageX’ plot_spatial_pie: no visible binding for global variable ‘imageY’ sc_mutations: no visible binding for global variable ‘mutation_index’ sc_mutations: no visible binding for global variable ‘bam_index’ sc_transcript_usage_chisq: no visible binding for global variable ‘p.value’ sc_transcript_usage_chisq: no visible binding for global variable ‘adj.p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘total’ sc_transcript_usage_permutation: no visible binding for global variable ‘test’ sc_transcript_usage_permutation : <anonymous> : <anonymous>: no visible global function definition for ‘na.omit’ sc_transcript_usage_permutation: no visible binding for global variable ‘transcript’ sc_transcript_usage_permutation: no visible binding for global variable ‘p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘adj.p.value’ variant_count_tb: no visible binding for global variable ‘barcode’ variant_count_tb: no visible binding for global variable ‘allele_count’ variant_count_tb: no visible binding for global variable ‘cell_total_reads’ Undefined global functions or variables: BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count bam_index barcode barcode_rank cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed reads everything expr filter_res head imageX imageY in_tissue input length_bin max_length min_length multi-matching reads mutation_index n_reads na.omit name nucleotide output p.value pct pos read1_with_adapter read_counts ref scale_alpha_continuous scale_colour_gradient single match reads starts_with test total total reads total_counts tr_length transcript undemultiplexted reads value which_label x y Consider adding importFrom("base", "match", "single") importFrom("stats", "chisq.test", "na.omit") importFrom("utils", "head") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... NOTE Found the following Rd file(s) with Rd \link{} targets missing package anchors: bulk_long_pipeline.Rd: SummarizedExperiment sc_long_multisample_pipeline.Rd: SingleCellExperiment sc_long_pipeline.Rd: SingleCellExperiment Please provide package anchors for all Rd \link{} targets not in the package itself and the base packages. * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... INFO GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/libs/FLAMES.so’: Found ‘abort’, possibly from ‘abort’ (C) Found ‘exit’, possibly from ‘exit’ (C) Found ‘stderr’, possibly from ‘stderr’ (C) Found ‘stdout’, possibly from ‘stdout’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed plot_isoform_reduced_dim 24.335 0.676 25.035 bulk_long_pipeline 21.411 1.091 20.569 sc_long_multisample_pipeline 13.515 5.884 13.718 create_se_from_dir 17.166 0.511 15.297 sc_DTU_analysis 8.730 2.533 9.290 plot_isoform_heatmap 8.591 0.499 9.090 plot_coverage 6.825 0.247 7.143 find_isoform 6.752 0.189 7.010 get_GRangesList 6.751 0.176 7.002 minimap2_align 6.660 0.164 6.897 create_sce_from_dir 4.054 2.258 4.889 sc_long_pipeline 3.953 1.583 3.544 find_variants 4.352 0.747 5.097 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking re-building of vignette outputs ... OK * checking PDF version of manual ... OK * DONE Status: 4 NOTEs See ‘/home/biocbuild/bbs-3.21-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.21-bioc/R/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.21-bioc/R/site-library’ * installing *source* package ‘FLAMES’ ... ** this is package ‘FLAMES’ version ‘2.2.0’ ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘g++ (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0’ using C++17 g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c RcppExports.cpp -o RcppExports.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c RcppFunctions.cpp -o RcppFunctions.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/BamRecord.cpp -o classes/BamRecord.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/GFFRecord.cpp -o classes/GFFRecord.o In file included from classes/GFFRecord.cpp:8: classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’: classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 255 | for (int i = 0; i < s.size(); i++) { | ~~^~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/GeneAnnotationParser.cpp -o classes/GeneAnnotationParser.o In file included from classes/GeneAnnotationParser.cpp:15: classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’: classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 255 | for (int i = 0; i < s.size(); i++) { | ~~^~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/Isoforms.cpp -o classes/Isoforms.o In file included from classes/Isoforms.cpp:16: classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’: classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 255 | for (int i = 0; i < s.size(); i++) { | ~~^~~~~~~~~~ classes/Isoforms.cpp: In member function ‘void Isoforms::update_all_splice()’: classes/Isoforms.cpp:233:35: warning: comparison of integer expressions of different signedness: ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 233 | if (blocks.size() >= (int)this->Min_sup_cnt) { | ~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~ classes/Isoforms.cpp: In member function ‘void Isoforms::filter_TSS_TES(std::ofstream&, DoubleJunctions, float)’: classes/Isoforms.cpp:368:33: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 368 | if ((left_counts.size() < (int)this->Min_sup_cnt) || | ~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~ classes/Isoforms.cpp:369:38: warning: comparison of integer expressions of different signedness: ‘std::unordered_map<int, int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 369 | (right_counts.size() < (int)this->Min_sup_cnt)) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~ classes/Isoforms.cpp: In member function ‘void Isoforms::match_known_annotation(const std::unordered_map<std::__cxx11::basic_string<char>, Junctions>&, const std::unordered_map<std::__cxx11::basic_string<char>, Pos>&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&, GeneBlocks, std::unordered_map<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> >)’: classes/Isoforms.cpp:662:51: warning: comparison of integer expressions of different signedness: ‘int’ and ‘const long unsigned int’ [-Wsign-compare] 662 | for (int j = 0; j < std::min(raw_iso_key.size() - 1, junction.junctions.size()); j++) { | ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ classes/Isoforms.cpp:713:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 713 | for (int i = 0; i < new_exons.size(); ++i) { | ~~^~~~~~~~~~~~~~~~~~ classes/Isoforms.cpp:725:46: warning: comparisons like ‘X<=Y<=Z’ do not have their mathematical meaning [-Wparentheses] 725 | } else if (0 < i < raw_iso_key.size() - 1) { // a site from the middle somewhere | ~~^~~ classes/Isoforms.cpp: In member function ‘std::string Isoforms::isoform_to_gff3(float)’: classes/Isoforms.cpp:1140:43: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 1140 | for (int i = 0; i < exons.size(); i+=2) { | ~~^~~~~~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c classes/junctions.cpp -o classes/junctions.o In file included from classes/junctions.cpp:12: classes/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’: classes/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 255 | for (int i = 0; i < s.size(); i++) { | ~~^~~~~~~~~~ classes/junctions.cpp: In function ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> > get_gene_flat(const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::__cxx11::basic_string<char> > >&, const std::unordered_map<std::__cxx11::basic_string<char>, std::vector<StartEndPair> >&)’: classes/junctions.cpp:166:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<StartEndPair>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 166 | for (int i = 1; i < exons.size(); i++) { | ~~^~~~~~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/find_isoform.cpp -o main-functions/find_isoform.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/flexiplex.cpp -o main-functions/flexiplex.o main-functions/flexiplex.cpp: In function ‘unsigned int edit_distance(const std::string&, const std::string&, unsigned int&, int)’: main-functions/flexiplex.cpp:122:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 122 | if (min_value <= max_editd) | ~~~~~~~~~~^~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘std::string get_umi(const std::string&, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&, const std::vector<int>&, int, int, bool, int, int)’: main-functions/flexiplex.cpp:163:22: warning: comparison of integer expressions of different signedness: ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 163 | if (seq.length() < umi_start + umi_length) { | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:187:36: warning: comparison of integer expressions of different signedness: ‘std::vector<int>::size_type’ {aka ‘long unsigned int’} and ‘int’ [-Wsign-compare] 187 | if (read_to_subpatterns.size() > umi_index + 1) { | ~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘Barcode get_barcode(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’: main-functions/flexiplex.cpp:295:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare] 295 | if (i_pattern >= subpattern_ends[i_subpattern]) { main-functions/flexiplex.cpp:354:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 354 | if (editDistance == barcode.editd) { | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:356:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 356 | } else if (editDistance < barcode.editd && | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:357:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 357 | editDistance <= barcode_max_editd) { // if best so far, update | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const std::string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’: main-functions/flexiplex.cpp:396:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 396 | if (barcode.flank_end == std::string::npos) { | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘void print_stats(const std::string&, const std::vector<Barcode>&, std::ostream&)’: main-functions/flexiplex.cpp:421:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 421 | << (barcode.flank_end == std::string::npos ? "True" : "False") | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘void print_read(const std::string&, const std::string&, const std::string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool, bool, bool)’: main-functions/flexiplex.cpp:453:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 453 | for (int b = 0; b < vec_bc.size(); b++) { | ~~^~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:468:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const std::__cxx11::basic_string<char>::size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 468 | if (vec_bc.at(b).flank_end == std::string::npos) { | ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:473:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 473 | for (int f = 0; f < vec_bc.size(); f++) { | ~~^~~~~~~~~~~~~~~ main-functions/flexiplex.cpp: In function ‘Rcpp::IntegerVector flexiplex_cpp(Rcpp::StringVector, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, bool, int)’: main-functions/flexiplex.cpp:730:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 730 | for (int t = 0; t < sr_v.size(); | ~~^~~~~~~~~~~~~ main-functions/flexiplex.cpp:735:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 735 | for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads | ~~^~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:737:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 737 | for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++) | ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ main-functions/flexiplex.cpp:739:29: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 739 | for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++) | ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/get_transcript_seq.cpp -o main-functions/get_transcript_seq.o main-functions/get_transcript_seq.cpp: In function ‘void write_fa(const std::string&, const std::string&, const std::string&, int)’: main-functions/get_transcript_seq.cpp:87:14: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 87 | while (i < seq.size()) { | ~~^~~~~~~~~~~~ main-functions/get_transcript_seq.cpp:88:26: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 88 | if (i + wrap_len > seq.size()) { | ~~~~~~~~~~~~~^~~~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/group_bam2isoform.cpp -o main-functions/group_bam2isoform.o In file included from main-functions/group_bam2isoform.cpp:18: main-functions/../utility/utility.h: In function ‘std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > parseSpace(const std::string&)’: main-functions/../utility/utility.h:255:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::__cxx11::basic_string<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 255 | for (int i = 0; i < s.size(); i++) { | ~~^~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c main-functions/pileup_readid.cpp -o main-functions/pileup_readid.o main-functions/pileup_readid.cpp: In function ‘Rcpp::NumericMatrix variant_count_matrix_cpp(Rcpp::String, Rcpp::String, int, bool, bool)’: main-functions/pileup_readid.cpp:268:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<char>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 268 | for (int i = 0; i < BASES.size(); i++) { | ~~^~~~~~~~~~~~~~ main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, unsigned int> > >]’: main-functions/pileup_readid.cpp:342:30: required from here main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable] 86 | unsigned int end; | ^~~ main-functions/pileup_readid.cpp: In instantiation of ‘std::unordered_map<std::__cxx11::basic_string<char>, std::vector<std::vector<std::__cxx11::basic_string<char> > > > group_umis(const TableType&, int) [with TableType = std::unordered_map<std::__cxx11::basic_string<char>, std::unordered_map<std::__cxx11::basic_string<char>, std::array<unsigned int, 5> > >]’: main-functions/pileup_readid.cpp:344:30: required from here main-functions/pileup_readid.cpp:86:16: warning: unused variable ‘end’ [-Wunused-variable] g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c tests/test-junctions.cpp -o tests/test-junctions.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c tests/test-parsing.cpp -o tests/test-parsing.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/cigars.cpp -o utility/cigars.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o gcc -std=gnu2x -I"/home/biocbuild/bbs-3.21-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.21-bioc/R/site-library/testthat/include' -I/usr/local/include -fpic -g -O2 -Wall -Werror=format-security -c utility/bam.c -o utility/bam.o g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.21-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o RcppFunctions.o classes/BamRecord.o classes/GFFRecord.o classes/GeneAnnotationParser.o classes/Isoforms.o classes/junctions.o main-functions/find_isoform.o main-functions/flexiplex.o main-functions/get_transcript_seq.o main-functions/group_bam2isoform.o main-functions/pileup_readid.o tests/test-junctions.o tests/test-parsing.o utility/cigars.o utility/edlib-1.2.7/edlib.o utility/bam.o -pthread -lz /home/biocbuild/bbs-3.21-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.21-bioc/R/lib -lR if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices *** copying figures ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.5.1 (2025-06-13) -- "Great Square Root" Copyright (C) 2025 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > # This file is part of the standard setup for testthat. > # It is recommended that you do not modify it. > # > # Where should you do additional test configuration? > # Learn more about the roles of various files in: > # * https://r-pkgs.org/tests.html > # * https://testthat.r-lib.org/reference/test_package.html#special-files > > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmpcFDCSC/file4011e48cbebbb/config_file_262430.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e3a85661e/bc_allow.tsv Number of known barcodes: 143 Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e47ef5c04/bc_allow.tsv Number of known barcodes: 143 Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e47ef5c04/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpcFDCSC/file4011e6e046c95/musc_rps24_1.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6e046c95/musc_rps24_2.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6e046c95/musc_rps24_3.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6e046c95/musc_rps24_4.fastq Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e62bb44f2/bc_allow.tsv Number of known barcodes: 143 Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e62bb44f2/bc_allow.tsv Number of known barcodes: 143 Processing file: /tmp/RtmpcFDCSC/file4011e6869bda/musc_rps24_1.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6869bda/musc_rps24_2.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6869bda/musc_rps24_3.fastq Searching for barcodes... Processing file: /tmp/RtmpcFDCSC/file4011e6869bda/musc_rps24_4.fastq Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e62bb44f2/bc_allow.tsv Number of known barcodes: 143 Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpcFDCSC/file4011e564a9af7/bc_allow.tsv Number of known barcodes: 143 Processing file: /home/biocbuild/bbs-3.21-bioc/R/site-library/FLAMES/extdata/fastq/musc_rps24.fastq.gz Searching for barcodes... Number of reads processed: 393 Number of reads where at least one barcode was found: 368 Number of reads with exactly one barcode match: 364 Number of chimera reads: 1 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 13 ] > > proc.time() user system elapsed 19.876 1.028 20.898
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
add_gene_counts | 0.412 | 0.005 | 0.419 | |
annotation_to_fasta | 1.212 | 0.016 | 1.229 | |
blaze | 0.332 | 0.029 | 1.969 | |
bulk_long_pipeline | 21.411 | 1.091 | 20.569 | |
combine_sce | 0.664 | 0.059 | 0.723 | |
convolution_filter | 0.001 | 0.000 | 0.000 | |
create_config | 0.004 | 0.002 | 0.006 | |
create_sce_from_dir | 4.054 | 2.258 | 4.889 | |
create_se_from_dir | 17.166 | 0.511 | 15.297 | |
cutadapt | 0.114 | 0.023 | 0.136 | |
filter_annotation | 0.632 | 0.076 | 0.707 | |
filter_coverage | 3.800 | 0.275 | 4.142 | |
find_barcode | 0.703 | 0.133 | 0.837 | |
find_bin | 0.012 | 0.005 | 0.017 | |
find_isoform | 6.752 | 0.189 | 7.010 | |
find_variants | 4.352 | 0.747 | 5.097 | |
get_GRangesList | 6.751 | 0.176 | 7.002 | |
get_coverage | 3.982 | 0.204 | 4.265 | |
minimap2_align | 6.660 | 0.164 | 6.897 | |
minimap2_realign | 0.670 | 0.057 | 0.726 | |
mutation_positions | 1.759 | 0.258 | 2.016 | |
plot_coverage | 6.825 | 0.247 | 7.143 | |
plot_demultiplex | 1.593 | 0.054 | 1.648 | |
plot_isoform_heatmap | 8.591 | 0.499 | 9.090 | |
plot_isoform_reduced_dim | 24.335 | 0.676 | 25.035 | |
plot_isoforms | 3.165 | 0.062 | 3.227 | |
quantify_transcript | 1.939 | 0.099 | 2.115 | |
quantify_transcript_flames | 1.807 | 0.045 | 1.931 | |
sc_DTU_analysis | 8.730 | 2.533 | 9.290 | |
sc_impute_transcript | 0.623 | 0.016 | 0.640 | |
sc_long_multisample_pipeline | 13.515 | 5.884 | 13.718 | |
sc_long_pipeline | 3.953 | 1.583 | 3.544 | |
sc_mutations | 2.056 | 0.573 | 2.625 | |
weight_transcripts | 0.024 | 0.014 | 0.038 | |