Changqing Wang
| Snapshot Date: 2024-03-17 14:00:14 -0400 (Sun, 17 Mar 2024) |
| git_url: https://git.bioconductor.org/packages/FLAMES |
| git_branch: devel |
| git_last_commit: 38c29f8 |
| git_last_commit_date: 2024-01-19 01:44:50 -0400 (Fri, 19 Jan 2024) |
| Back to Multiple platform build/check report for BioC 3.19: simplified long |
|
This page was generated on 2024-03-18 11:40:11 -0400 (Mon, 18 Mar 2024).
| Hostname | OS | Arch (*) | R version | Installed pkgs |
|---|---|---|---|---|
| nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | R Under development (unstable) (2024-03-06 r86056) -- "Unsuffered Consequences" | 4685 |
| palomino3 | Windows Server 2022 Datacenter | x64 | R Under development (unstable) (2024-03-06 r86056 ucrt) -- "Unsuffered Consequences" | 4423 |
| lconway | macOS 12.7.1 Monterey | x86_64 | R Under development (unstable) (2024-03-04 r86048) -- "Unsuffered Consequences" | 4450 |
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | R Under development (unstable) (2024-03-06 r86056) -- "Unsuffered Consequences" | 4361 |
| Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X | ||||
| Package 716/2257 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
| FLAMES 1.9.0 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | ERROR | |||||||||
| palomino3 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
| lconway | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | | ||||||||
| kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | ERROR | ||||||||||
|
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. - See Martin Grigorov's blog post for how to debug Linux ARM64 related issues on a x86_64 host. |
| Package: FLAMES |
| Version: 1.9.0 |
| Command: /home/biocbuild/R/R-4.4-devel-2024.03.07/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library --no-vignettes --timings FLAMES_1.9.0.tar.gz |
| StartedAt: 2024-03-18 04:46:23 -0000 (Mon, 18 Mar 2024) |
| EndedAt: 2024-03-18 04:55:48 -0000 (Mon, 18 Mar 2024) |
| EllapsedTime: 564.2 seconds |
| RetCode: 1 |
| Status: ERROR |
| CheckDir: FLAMES.Rcheck |
| Warnings: NA |
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/R/R-4.4-devel-2024.03.07/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library --no-vignettes --timings FLAMES_1.9.0.tar.gz
###
##############################################################################
##############################################################################
* using log directory ‘/home/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck’
* using R Under development (unstable) (2024-03-06 r86056)
* using platform: aarch64-unknown-linux-gnu
* R was compiled by
gcc (GCC) 10.3.1
GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.9.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
.BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
Non-staged installation was used
See ‘/home/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (GCC) 10.3.1’
* checking C++ specification ... OK
Not all R platforms support C++17
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotation_to_fasta: no visible global function definition for
'write.table'
find_variants: no visible binding for global variable 'nucleotide'
find_variants: no visible binding for global variable 'ref'
find_variants : <anonymous>: no visible binding for global variable
'pos'
find_variants : <anonymous>: no visible binding for global variable
'count'
find_variants: no visible binding for global variable 'count'
generate_sc_sce: no visible binding for global variable 'FSM_match'
homopolymer_pct : <anonymous>: no visible binding for global variable
'Freq'
homopolymer_pct : <anonymous>: no visible binding for global variable
'pct'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
variable 'heatmap_annotation_colors'
sc_umap_expression: no visible binding for global variable
'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
'x'
sc_umap_expression : plot_idx: no visible binding for global variable
'y'
transcript_coverage: no visible binding for global variable 'mat'
Undefined global functions or variables:
. BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt
count everything gene_id heatmap_annotation_colors label length_bin
mat n name nucleotide pct pos ref tr_id transcript transcript_id
value write.table x y
Consider adding
importFrom("utils", "write.table")
to your NAMESPACE file.
* checking Rd files ... NOTE
checkRd: (-1) bulk_long_pipeline.Rd:77-78: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:79-80: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:81-83: Lost braces in \itemize; meant \describe ?
checkRd: (-1) bulk_long_pipeline.Rd:37: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:38: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:39: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:40: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:41: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) bulk_long_pipeline.Rd:42: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) create_config.Rd:14: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:15: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:20: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:21: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:22: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:23: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:24: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:25: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:26: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:27: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:28: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:29: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:30: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:31: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:32: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:33: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:34: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:35: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:36: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:37: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:38: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:39: Lost braces in \itemize; meant \describe ?
checkRd: (-1) create_config.Rd:40: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_DTU_analysis.Rd:18: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:19: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:20: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:21: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:22: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:23: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_DTU_analysis.Rd:24: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_multisample_pipeline.Rd:85-86: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:87-88: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_multisample_pipeline.Rd:89-91: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:91-92: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:93-94: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:95-97: Lost braces in \itemize; meant \describe ?
checkRd: (-1) sc_long_pipeline.Rd:50: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:51: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:52: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:53: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:54: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_long_pipeline.Rd:55: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:43: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:45: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:46: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:47: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:48: Lost braces in \itemize; \value handles \item{}{} directly
checkRd: (-1) sc_mutations.Rd:52: Lost braces in \itemize; \value handles \item{}{} directly
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘FLAMES-Ex.R’ failed
The error most likely occurred in:
> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: annotation_to_fasta
> ### Title: GTF/GFF to FASTA conversion
> ### Aliases: annotation_to_fasta
>
> ### ** Examples
>
> fasta <- annotation_to_fasta(system.file("extdata/rps24.gtf.gz", package = "FLAMES"), system.file("extdata/rps24.fa.gz", package = "FLAMES"), tempdir())
Error in load_package_gracefully("txdbmaker", "Starting with BioC 3.19, ", :
Could not load package txdbmaker. Is it installed?
Note that Starting with BioC 3.19, calling makeTxDbFromGFF() requires
the txdbmaker package. Please install it with:
BiocManager::install("txdbmaker")
Calls: annotation_to_fasta ... <Anonymous> -> call_fun_in_txdbmaker -> load_package_gracefully
Execution halted
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
Running ‘testthat.R’
OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE
Status: 1 ERROR, 6 NOTEs
See
‘/home/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00check.log’
for details.
FLAMES.Rcheck/00install.out
##############################################################################
##############################################################################
###
### Running command:
###
### /home/biocbuild/R/R-4.4-devel-2024.03.07/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################
* installing to library ‘/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (GCC) 10.3.1’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4-devel-2024.03.07/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/zlibbioc/include' -I/usr/local/include -fPIC -g -O2 -Wall -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4-devel-2024.03.07/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/zlibbioc/include' -I/usr/local/include -fPIC -g -O2 -Wall -c flexiplex.cpp -o flexiplex.o
flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’:
flexiplex.cpp:118:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
118 | if (min_value <= max_editd)
| ~~~~~~~~~~^~~~~~~~~~~~
flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:224:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
224 | if (i_pattern >= subpattern_ends[i_subpattern]) {
flexiplex.cpp:285:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
285 | if (editDistance == barcode.editd) {
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
flexiplex.cpp:287:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
287 | } else if (editDistance < barcode.editd &&
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
flexiplex.cpp:288:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
288 | editDistance <= barcode_max_editd) { // if best so far, update
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:350:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
350 | if (barcode.flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’:
flexiplex.cpp:375:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
375 | << (barcode.flank_end == std::string::npos ? "True" : "False")
| ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool)’:
flexiplex.cpp:400:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
400 | for (int b = 0; b < vec_bc.size(); b++) {
| ~~^~~~~~~~~~~~~~~
flexiplex.cpp:410:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
410 | if (vec_bc.at(b).flank_end == std::string::npos) {
| ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:415:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
415 | for (int f = 0; f < vec_bc.size(); f++) {
| ~~^~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘int flexiplex(Rcpp::String, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, int)’:
flexiplex.cpp:634:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
634 | for (int t = 0; t < sr_v.size();
| ~~^~~~~~~~~~~~~
flexiplex.cpp:639:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
639 | for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
| ~~^~~~~~~~~~~~~~~~
flexiplex.cpp:641:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
641 | for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:643:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
643 | for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
| ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/R/R-4.4-devel-2024.03.07/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rcpp/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rhtslib/include' -I'/home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/zlibbioc/include' -I/usr/local/include -fPIC -g -O2 -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
g++ -std=gnu++17 -shared -L/home/biocbuild/R/R-4.4-devel-2024.03.07/lib -L/usr/local/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/R/R-4.4-devel-2024.03.07/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/R/R-4.4-devel-2024.03.07/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R Under development (unstable) (2024-03-06 r86056) -- "Unsuffered Consequences"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: aarch64-unknown-linux-gnu
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> library(testthat)
> library(FLAMES)
>
> test_check("FLAMES")
Writing configuration parameters to: /home/biocbuild/tmp/RtmprWSxIf/file1bc957656983f1/config_file_1821015.json
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be replaced
Setting number of threads to 1
Search pattern:
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /home/biocbuild/tmp/RtmprWSxIf/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
>
> proc.time()
user system elapsed
26.590 1.645 28.286
FLAMES.Rcheck/FLAMES-Ex.timings
| name | user | system | elapsed |