The crisprBase package is a core package of the crisprVerse ecosystem that
provides S4 classes for representing CRISPR nucleases and base editors.
It also provides arithmetic functions to extract genomic ranges to help
with the design and manipulation of CRISPR guide-RNAs (gRNAs). The
classes and functions are designed to work with a broad spectrum of
nucleases and applications, including PAM-free CRISPR nucleases,
RNA-targeting nucleases, and the more general class of restriction
enzymes. It also includes functionalities for CRISPR nickases.
It provides a language and convention for our gRNA design ecosystem described in our recent bioRxiv preprint: “The crisprVerse: a comprehensive Bioconductor ecosystem for the design of CRISPR guide RNAs across nucleases and technologies”
This package is supported for macOS, Linux and Windows machines. It was developed and tested on R version 4.2.
The Nuclease class is designed to store minimal
information about the recognition sites of general nucleases, such as
restriction enzymes. The Nuclease class has 5 fields:
nucleaseName, targetType,
metadata, motifs and weights. The
nucleaseName field is a string specifying a name for the
nuclease. The targetType specifies if the nuclease targets
“DNA” (deoxyribonucleases) or “RNA” (ribonucleases). The
metadata field is a list of arbitrary length
to store additional information about the nuclease.
The motifs field is a character vector that specify one
of several DNA sequence motifs that are recognized by the nuclease for
cleavage (always in the 5’ to 3’ direction). The optional
weights field is a numeric vector specifying relative
cleavage probabilities corresponding to the motifs specified by
motifs. Note that we use DNA to represent motifs
irrespectively of the target type for simplicity.
We use the Rebase convention to represent motif sequences (Roberts et al. 2010). For enzymes that cleave
within the recognition site, we add the symbol ^ within the
recognition sequence to specify the cleavage site, always in the 5’ to
3’ direction. For enzymes that cleave away from the recognition site, we
specify the distance of the cleavage site using a (x/y)
notation where x represents the number of nucleotides away
from the recognition sequence on the original strand, and y
represents the number of nucleotides away from the recognition sequence
on the reverse strand.
The EcoRI enzyme recognizes the palindromic motif
GAATTC, and cuts after the first nucleotide, which is
specified using the ^ below:
library(crisprBase)
EcoRI <- Nuclease("EcoRI",
targetType="DNA",
motifs=c("G^AATTC"),
metadata=list(description="EcoRI restriction enzyme"))The HgaI enzyme recognizes the motif GACGC, and cleaves
DNA at 5 nucleotides downstream of the recognition sequence on the
original strand, and at 10 nucleotides downstream of the recognition
sequence on the reverse strand:
HgaI <- Nuclease("HgaI",
targetType="DNA",
motifs=c("GACGC(5/10)"),
metadata=list(description="HgaI restriction enzyme"))In case the cleavage site was upstream of the recognition sequence,
we would instead specify (5/10)GACGC.
Note that any nucleotide letter that is part of the extended IUPAC
nucleic acid code can be used to represent recognition motifs. For
instance, we use Y and R (pyrimidine and
purine, respectively) to specify the possible recognition sequences for
PfaAI:
The accessor function motifs retrieve the motif
sequences:
## DNAStringSet object of length 1:
## width seq
## [1] 6 GGYRCC
To expand the motif sequence into all combinations of valid sequences
with only A/C/T/G nucleotides, users can use
expand=TRUE.
## DNAStringSet object of length 4:
## width seq names
## [1] 6 GGCACC GGYRCC
## [2] 6 GGTACC GGYRCC
## [3] 6 GGCGCC GGYRCC
## [4] 6 GGTGCC GGYRCC
CRISPR nucleases are examples of RNA-guided nucleases. For cleavage, it requires two binding components. For CRISPR nucleases targeting DNA, the nuclease needs to first recognize a constant nucleotide motif in the target DNA called the protospacer adjacent motif (PAM) sequence. Second, the guide-RNA (gRNA), which guides the nuclease to the target sequence, needs to bind to a complementary sequence adjacent to the PAM sequence (protospacer sequence). The latter can be thought of a variable binding motif that can be specified by designing corresponding gRNA sequences. For CRISPR nucleases targeting RNA, the equivalent of the PAM sequence is called the Protospacer Flanking Sequence (PFS). We use the terms PAM and PFS interchangeably as it should be clear from context.
The CrisprNuclease class allows to characterize both
binding components by extending the Nuclease class to
contain information about the gRNA sequences.The PAM sequence
characteristics, and the cleavage distance with respect to the PAM
sequence, are specified using the motif nomenclature described in the
Nuclease section above.
3 additional fields are required: pam_side,
spacer_length and spacer_gap. The
pam_side field can only take 2 values, 5prime
and 3prime, and specifies on which side the PAM sequence is
located with respect to the protospacer sequence. While it would be more
appropriate to use the terminology pfs_side for
RNA-targeting nucleases, we still use the term pam_side for
simplicity.
The spacer_length specifies a default spacer length, and
the spacer_gap specifies a distance (in nucleotides)
between the PAM (or PFS) sequence and spacer sequence. For most
nucleases,spacer_gap=0 as the spacer sequence is located
directly next to the PAM/PFS sequence.
We show how we construct a CrisprNuclease object for the
commonly-used Cas9 nuclease (Streptococcus pyogenes Cas9):
SpCas9 <- CrisprNuclease("SpCas9",
targetType="DNA",
pams=c("(3/3)NGG", "(3/3)NAG", "(3/3)NGA"),
weights=c(1, 0.2593, 0.0694),
metadata=list(description="Wildtype Streptococcus pyogenes Cas9 (SpCas9) nuclease"),
pam_side="3prime",
spacer_length=20)
SpCas9## Class: CrisprNuclease
## Name: SpCas9
## Target type: DNA
## Metadata: list of length 1
## PAMs: NGG, NAG, NGA
## Weights: 1, 0.2593, 0.0694
## Spacer length: 20
## PAM side: 3prime
## Distance from PAM: 0
## Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSS[NGG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NAG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NGA]--3'
Similar to the Nuclease class, we can specify PAM
sequences using the extended nucleotide code. SaCas9 serves as a good
example:
SaCas9 <- CrisprNuclease("SaCas9",
targetType="DNA",
pams=c("(3/3)NNGRRT"),
metadata=list(description="Wildtype Staphylococcus
aureus Cas9 (SaCas9) nuclease"),
pam_side="3prime",
spacer_length=21)
SaCas9## Class: CrisprNuclease
## Name: SaCas9
## Target type: DNA
## Metadata: list of length 1
## PAMs: NNGRRT
## Weights: 1
## Spacer length: 21
## PAM side: 3prime
## Distance from PAM: 0
## Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSSS[NNGRRT]--3'
Here is another example where we construct a
CrisprNuclease object for the commonly-used Cas12a nuclease
(AsCas12a):
AsCas12a <- CrisprNuclease("AsCas12a",
targetType="DNA",
pams="TTTV(18/23)",
metadata=list(description="Wildtype Acidaminococcus
Cas12a (AsCas12a) nuclease."),
pam_side="5prime",
spacer_length=23)
AsCas12a## Class: CrisprNuclease
## Name: AsCas12a
## Target type: DNA
## Metadata: list of length 1
## PAMs: TTTV
## Weights: 1
## Spacer length: 23
## PAM side: 5prime
## Distance from PAM: 0
## Prototype protospacers: 5'--[TTTV]SSSSSSSSSSSSSSSSSSSSSSS--3'
Several already-constructed crisprNuclease objects are
available in crisprBase, see
data(package="crisprBase").
The terms spacer and protospacer are not interchangeable. spacer refers to the sequence used in the gRNA construct to guide the Cas nuclease to the target protospacer sequence in the host genome / transcriptome. The protospacer sequence is adjacent to the PAM sequence / PFS sequence. We use the terminology target sequence to refer to the protospacer and PAM sequence taken together. For DNA-targeting nucleases such as Cas9 and Cas12a, the spacer and protospacer sequences are identical from a nucleotide point of view. For RNA-targeting nucleases such as Cas13d, the spacer and protospacer sequences are the reverse complement of each other.
An gRNA spacer sequence does not always uniquely target the host genome (a given sgRNA spacer can map to multiple protospacers in the genome). However, for a given reference genome, protospacer sequences can be uniquely identified using a combination of 3 attributes:
pfs_site for simplicity).For convention, we used the nucleotide directly downstream of the DNA cut to represent the cut site nucleotide position. For instance, for SpCas9 (blunt-ended dsDNA break), the cut site occurs at position -3 with respect to the PAM site. For AsCas12a, the 5nt overhang dsDNA break occurs at 18 nucleotides after the PAM sequence on the targeted strand. Therefore the cute site on the forward strand occurs at position 22 with respect to the PAM site, and at position 27 on the reverse strand.
The convenience function cutSites extracts the cut site
coordinates relative to the PAM site:
## [1] -3
## [1] -3
## [1] 22
## [1] 27
Below is an illustration of how different motif sequences and cut patterns translate into cut site coordinates with respect to a PAM sequence NGG:
Given a list of target sequences (protospacer + PAM) and a
CrisprNuclease object, one can extract protospacer and PAM
sequences using the functions extractProtospacerFromTarget
and extractPamFromTarget, respectively.
targets <- c("AGGTGCTGATTGTAGTGCTGCGG",
"AGGTGCTGATTGTAGTGCTGAGG")
extractPamFromTarget(targets, SpCas9)## [1] "CGG" "AGG"
## [1] "AGGTGCTGATTGTAGTGCTG" "AGGTGCTGATTGTAGTGCTG"
Given a PAM coordinate, there are several functions in
crisprBase that allows to get get coordinates of the full
PAM sequence, protospacer sequence, and target sequence:
getPamRanges, getTargetRanges, and
getProtospacerRanges, respectively. The output objects are
GRanges:
chr <- rep("chr7",2)
pam_site <- rep(200,2)
strand <- c("+", "-")
gr_pam <- getPamRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=SpCas9)
gr_protospacer <- getProtospacerRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=SpCas9)
gr_target <- getTargetRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=SpCas9)
gr_pam## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 200-202 +
## [2] chr7 198-200 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 180-199 +
## [2] chr7 201-220 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 180-202 +
## [2] chr7 198-220 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
and for AsCas12a:
gr_pam <- getPamRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=AsCas12a)
gr_protospacer <- getProtospacerRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=AsCas12a)
gr_target <- getTargetRanges(seqnames=chr,
pam_site=pam_site,
strand=strand,
nuclease=AsCas12a)
gr_pam## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 200-203 +
## [2] chr7 197-200 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 204-226 +
## [2] chr7 174-196 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
## GRanges object with 2 ranges and 0 metadata columns:
## seqnames ranges strand
## <Rle> <IRanges> <Rle>
## [1] chr7 200-226 +
## [2] chr7 174-200 -
## -------
## seqinfo: 1 sequence from an unspecified genome; no seqlengths
Base editors are inactive Cas nucleases coupled with a specific deaminase. For instance, the first cytosine base editor (CBE) was obtained by coupling a cytidine deaminase with dCas9 to convert Cs to Ts (Komor et al. 2016).
We provide in crisprBase a S4 class,
BaseEditor, to represent base editors. It extends the
CrisprNuclase class with 3 additional fields:
baseEditorName: string specifying the name of the base
editor.editingStrand: strand where the editing happens with
respect to the target protospacer sequence (“original” or
“opposite”).editingWeights: a matrix of experimentally-derived
editing weights.We now show how to build a BaseEditor object with the
CBE base editor BE4max with weights obtained from Arbab et al. (2020).
We first obtain a matrix of weights for the BE4max editor stored in
the package crisprBase:
# Creating weight matrix
weightsFile <- system.file("be/b4max.csv",
package="crisprBase",
mustWork=TRUE)
ws <- t(read.csv(weightsFile))
ws <- as.data.frame(ws)The row names of the matrix must correspond to the nucleotide substitutions Nucleotide substitutions that are not present in the matrix will have weight assigned to 0.
## [1] "Position" "C2A" "C2G" "C2T" "G2A" "G2C"
The column names must correspond to the relative position with respect to the PAM site.
colnames(ws) <- ws["Position",]
ws <- ws[-c(match("Position", rownames(ws))),,drop=FALSE]
ws <- as.matrix(ws)
head(ws)## -36 -35 -34 -33 -32 -31 -30 -29 -28 -27 -26 -25 -24 -23 -22 -21 -20 -19
## C2A 0.0 0.0 0.0 0.7 0.1 0.2 0.0 0.2 0.3 0.0 0.2 0.0 0.9 0.0 0.1 0.2 0.1 0.3
## C2G 0.9 0.1 0.1 0.0 0.3 0.7 0.1 0.1 0.7 0.0 0.4 0.1 0.1 0.1 0.1 0.1 0.0 0.5
## C2T 0.7 0.7 0.8 1.8 1.0 2.0 1.4 1.2 2.3 1.3 2.4 2.2 3.4 2.2 2.1 3.5 5.8 16.2
## G2A 0.0 0.0 0.5 0.0 0.0 0.3 0.4 1.1 0.9 0.6 0.3 1.7 0.7 0.8 0.1 0.3 0.1 0.0
## G2C 0.1 0.0 0.0 0.0 0.6 2.8 0.0 0.0 0.3 0.2 0.2 0.1 0.0 0.3 0.0 0.0 0.0 0.0
## -18 -17 -16 -15 -14 -13 -12 -11 -10 -9 -8 -7 -6 -5 -4 -3
## C2A 1.0 2.0 2.7 3.00 2.7 1.9 0.8 0.6 0.3 0.0 0.1 0.1 0.1 0.0 0.0 0.0
## C2G 1.3 2.7 4.7 5.40 5.6 3.9 1.7 0.6 0.6 0.4 0.5 0.1 0.0 0.1 0.0 0.0
## C2T 31.8 63.2 90.3 100.00 87.0 62.0 31.4 16.3 10.0 5.6 3.3 1.9 1.8 2.4 1.7 0.5
## G2A 0.0 0.0 0.1 0.01 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.2 0.2 0.0
## G2C 0.0 0.0 0.2 0.00 0.0 0.1 0.1 0.2 0.2 0.0 0.0 0.0 0.1 0.0 0.0 0.0
## -2 -1
## C2A 0.0 0.0
## C2G 0.0 0.0
## C2T 0.2 0.1
## G2A 0.0 0.1
## G2C 0.0 0.0
Since BE4max uses Cas9, we can use the SpCas9
CrisprNuclease object available in crisprBase
to build the BaseEditor object:
data(SpCas9, package="crisprBase")
BE4max <- BaseEditor(SpCas9,
baseEditorName="BE4max",
editingStrand="original",
editingWeights=ws,
scale=TRUE)
metadata(BE4max)$description_base_editor <- "BE4max cytosine base editor."
BE4max## Class: BaseEditor
## CRISPR Nuclease name: SpCas9
## Target type: DNA
## Metadata: list of length 2
## PAMs: NGG, NAG, NGA
## Weights: 1, 0.2593, 0.0694
## Spacer length: 20
## PAM side: 3prime
## Distance from PAM: 0
## Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSS[NGG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NAG]--3', 5'--SSSSSSSSSSSSSSSSSSSS[NGA]--3'
## Base editor name: BE4max
## Editing strand: original
## Maximum editing weight: C2T at position -15
The scale=TRUE forces the editing weights to be scaled
between 0 and 1 by dividing all weights by the largest weight value.
This can be set to FALSE if the editing weights are already
representing true editing probabilities, for instance.
One can quickly visualize the editing weights using the function
plotEditingWeights:
CRISPR nickases can be created by mutating one of the two nuclease domains of a CRISPR nuclease. They create single-strand breaks instead of double-strand breaks.
For instance, the D10A mutation of SpCas9 inactivates the RuvC domain, and the resulting CRISPR nickase (Cas9D10A) cleaves only the strand opposite to the protospacer sequence. The H840A mutation of SpCas9 inactivates the HNN domain, and the resulting CRISPR nickase (Cas9H840A) cleaves only the strand that contains the protospacer sequence. See Figure below.
The CrisprNickase class in crisprBase works
similar to the CrisprNuclease class:
Cas9D10A <- CrisprNickase("Cas9D10A",
nickingStrand="opposite",
pams=c("(3)NGG", "(3)NAG", "(3)NGA"),
weights=c(1, 0.2593, 0.0694),
metadata=list(description="D10A-mutated Streptococcus
pyogenes Cas9 (SpCas9) nickase"),
pam_side="3prime",
spacer_length=20)
Cas9H840A <- CrisprNickase("Cas9H840A",
nickingStrand="original",
pams=c("(3)NGG", "(3)NAG", "(3)NGA"),
weights=c(1, 0.2593, 0.0694),
metadata=list(description="H840A-mutated Streptococcus
pyogenes Cas9 (SpCas9) nickase"),
pam_side="3prime",
spacer_length=20)The nickingStrand field indicates which strand is being
cleaved by the nickase.
RNA-targeting CRISPR nucleases, such as the Cas13 family of nucleases and Csm complexes, target single-stranded RNA (ssRNA) instead of dsDNA as the name suggests.The equivalent of the PAM sequence is called Protospacer Flanking Sequence (PFS).
For RNA-targeting CRISPR nucleases, the spacer sequence is the reverse complement of the protospacer sequence. This differs from DNA-targeting CRISPR nucleases, for which the spacer and protospacer sequences are identical.
We can construct an RNA-targeting nuclease in way similar to a
DNA-targeting nuclease by specifying target="RNA". As an
example, we construct below a CrisprNuclease object for the CasRx
nuclease (Cas13d from Ruminococcus flavefaciens strain XPD3002):
CasRx <- CrisprNuclease("CasRx",
targetType="RNA",
pams="N",
metadata=list(description="CasRx nuclease"),
pam_side="3prime",
spacer_length=23)
CasRx## Class: CrisprNuclease
## Name: CasRx
## Target type: RNA
## Metadata: list of length 1
## PFS: N
## Weights: 1
## Spacer length: 23
## PFS side: 3prime
## Distance from PFS: 0
## Prototype protospacers: 5'--SSSSSSSSSSSSSSSSSSSSSSS[N]--3'
The CasRx and Csm nucleases are readily
available in crisprBase.
The CRISPR inhibition (CRISPRi) and CRISPR activation (CRISPRa) technologies uses modified versions of CRISPR nucleases that lack endonuclease activity, often referred to as “dead Cas” nucleases, such as the dCas9.
While fully-active Cas nucleases and dCas nucleases differ in terms
of applications and type of genomic perturbations, the gRNA design
remains unchanged in terms of spacer sequence search and genomic
coordinates. Therefore it is convenient to use the fully-active version
of the nuclease throughout crisprBase.
The project as a whole is covered by the MIT license.
## R version 4.5.2 (2025-10-31)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.3 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats graphics grDevices utils datasets methods base
##
## other attached packages:
## [1] crisprBase_1.14.0 BiocStyle_2.38.0
##
## loaded via a namespace (and not attached):
## [1] vctrs_0.7.1 crayon_1.5.3 cli_3.6.5
## [4] knitr_1.51 rlang_1.1.7 xfun_0.56
## [7] stringi_1.8.7 generics_0.1.4 jsonlite_2.0.0
## [10] glue_1.8.0 S4Vectors_0.48.0 buildtools_1.0.0
## [13] Biostrings_2.78.0 htmltools_0.5.9 maketools_1.3.2
## [16] sys_3.4.3 stats4_4.5.2 sass_0.4.10
## [19] rmarkdown_2.30 Seqinfo_1.0.0 evaluate_1.0.5
## [22] jquerylib_0.1.4 fastmap_1.2.0 IRanges_2.44.0
## [25] yaml_2.3.12 lifecycle_1.0.5 stringr_1.6.0
## [28] BiocManager_1.30.27 compiler_4.5.2 XVector_0.50.0
## [31] digest_0.6.39 R6_2.6.1 magrittr_2.0.4
## [34] GenomicRanges_1.62.1 bslib_0.10.0 tools_4.5.2
## [37] BiocGenerics_0.56.0 cachem_1.1.0