A quick overview of the S4 class system

What is S4?

The S4 class system

  • The S4 class system is a set of facilities provided in R for OO programming.
  • Implemented in the methods package.
  • On a fresh R session:
> sessionInfo()
...
attached base packages:
[1] stats     graphics  grDevices utils     datasets
[6] methods   base
  • R also supports an older class system: the S3 class system.

A different world

The syntax

foo(x, ...)

not:

x.foo(...)

like in other OO programming languages.

The central concepts

  • The core components: classes, generic functions and methods
  • The glue: method dispatch (supports simple and multiple dispatch)

The result

> ls('package:methods')
  [1] "addNextMethod"                   "allGenerics"
  [3] "allNames"                        "Arith"
  [5] "as"                              "as<-"
  [7] "asMethodDefinition"              "assignClassDef"
...
[211] "testVirtual"                     "traceOff"
[213] "traceOn"                         "tryNew"
[215] "unRematchDefinition"             "validObject"
[217] "validSlotNames"
  • Rich, complex, can be intimidating
  • The classes and methods we implement in our packages can be hard to document, especially when the class hierarchy is complicated and multiple dispatch is used

S4 in Bioconductor

  • Heavily used. In BioC 3.3: 3158 classes and 22511 methods defined in 609 packages! (out of 1211 software packages)
  • Top 10: 128 classes in ChemmineOB, 98 in flowCore, 79 in IRanges, 68 in rsbml, 61 in ShortRead, 58 in Biostrings, 51 in rtracklayer, 50 in oligoClasses, 45 in flowUtils, and 40 in BaseSpaceR.
  • For the end user: it’s mostly transparent. But when something goes wrong, error messages issued by the S4 class system can be hard to understand. Also it can be hard to find the documentation for a specific method.
  • Most Bioconductor packages use only a small subset of the S4 capabilities (covers 99.99% of our needs)

S4 from an end-user point of view

Where do S4 objects come from?

From a dataset

library(graph)
data(apopGraph)
apopGraph
## A graphNEL graph with directed edges
## Number of Nodes = 50 
## Number of Edges = 59

From using an object constructor function

library(IRanges)
IRanges(start=c(101, 25), end=c(110, 80))
## IRanges object with 2 ranges and 0 metadata columns:
##           start       end     width
##       <integer> <integer> <integer>
##   [1]       101       110        10
##   [2]        25        80        56

From a coercion

library(Matrix)
m <- matrix(3:-4, nrow=2)
as(m, "Matrix")
## 2 x 4 Matrix of class "dgeMatrix"
##      [,1] [,2] [,3] [,4]
## [1,]    3    1   -1   -3
## [2,]    2    0   -2   -4

From using a specialized high-level constructor

library(GenomicFeatures)
makeTxDbFromUCSC("sacCer2", tablename="ensGene")
TxDb object:
# Db type: TxDb
# Supporting package: GenomicFeatures
# Data source: UCSC
# Genome: sacCer2
# Organism: Saccharomyces cerevisiae
# Taxonomy ID: 4932
# UCSC Table: ensGene
# UCSC Track: Ensembl Genes
...

From using a high-level I/O function

library(ShortRead)
path_to_my_data <- system.file(
    package="ShortRead",
    "extdata", "Data", "C1-36Firecrest", "Bustard", "GERALD")
lane1 <- readFastq(path_to_my_data, pattern="s_1_sequence.txt")
lane1
## class: ShortReadQ
## length: 256 reads; width: 36 cycles

Inside another object

sread(lane1)
## DNAStringSet object of length 256:
##       width seq
##   [1]    36 GGACTTTGTAGGATACCCTCGCTTTCCTTCTCCTGT
##   [2]    36 GATTTCTTACCTATTAGTGGTTGAACAGCATCGGAC
##   [3]    36 GCGGTGGTCTATAGTGTTATTAATATCAATTTGGGT
##   [4]    36 GTTACCATGATGTTATTTCTTCATTTGGAGGTAAAA
##   [5]    36 GTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTT
##   ...   ... ...
## [252]    36 GTTTAGATATGAGTCACATTTTGTTCATGGTAGAGT
## [253]    36 GTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
## [254]    36 GATGAACTAAGTCAACCTCAGCACTAACCTTGCGAG
## [255]    36 GTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTA
## [256]    36 GCAATCTGCCGACCACTCGCGATTCAATCATGACTT

How to manipulate S4 objects?

Low-level: getters and setters

ir <- IRanges(start=c(101, 25), end=c(110, 80))
width(ir)
## [1] 10 56
width(ir) <- width(ir) - 5
ir
## IRanges object with 2 ranges and 0 metadata columns:
##           start       end     width
##       <integer> <integer> <integer>
##   [1]       101       105         5
##   [2]        25        75        51

High-level: plenty of specialized methods

qa1 <- qa(lane1, lane="lane1")
class(qa1)
## [1] "ShortReadQQA"
## attr(,"package")
## [1] "ShortRead"

How to find the right man page?

  • class?graphNEL or equivalently ?graphNEL-class`` for accessing the man page of a class
  • ?qa for accessing the man page of a generic function
  • The man page for a generic might also document some or all of the methods for this generic. The See Also: section might give a clue. Also using showMethods() can be useful:
showMethods("qa")
## Function: qa (package ShortRead)
## dirPath="ShortReadQ"
## dirPath="SolexaPath"
## dirPath="character"
## dirPath="list"
  • ?qa,ShortReadQ-method`` to access the man page for a particular method (might be the same man page as for the generic)
  • In doubt: ??qa will search the man pages of all the installed packages and return the list of man pages that contain the string qa

Inspecting objects and discovering methods

  • class() and showClass()
class(lane1)
## [1] "ShortReadQ"
## attr(,"package")
## [1] "ShortRead"
showClass("ShortReadQ")
## Class "ShortReadQ" [package "ShortRead"]
## 
## Slots:
##                                              
## Name:       quality        sread           id
## Class: QualityScore DNAStringSet   BStringSet
## 
## Extends: 
## Class "ShortRead", directly
## Class ".ShortReadBase", by class "ShortRead", distance 2
## 
## Known Subclasses: "AlignedRead"
  • str() for compact display of the content of an object
  • showMethods() to discover methods
  • selectMethod() to see the code

Implementing an S4 class (in 4 slides)

Class definition and constructor

Class definition

setClass("SNPLocations",
    slots=c(
      genome="character",  # a single string
      snpid="character",   # a character vector of length N
      chrom="character",   # a character vector of length N
      pos="integer"        # an integer vector of length N
    )
)

Constructor

SNPLocations <- function(genome, snpid, chrom, pos)
    new("SNPLocations", genome=genome, snpid=snpid, chrom=chrom, pos=pos)
snplocs <- SNPLocations("hg19",
             c("rs0001", "rs0002"),
             c("chr1", "chrX"),
             c(224033L, 1266886L))

Getters

Defining the length method

setMethod("length", "SNPLocations", function(x) length(x@snpid))
length(snplocs)  # just testing
## [1] 2

Defining the slot getters

setGeneric("genome", function(x) standardGeneric("genome"))
setMethod("genome", "SNPLocations", function(x) x@genome)
setGeneric("snpid", function(x) standardGeneric("snpid"))
setMethod("snpid", "SNPLocations", function(x) x@snpid)
setGeneric("chrom", function(x) standardGeneric("chrom"))
setMethod("chrom", "SNPLocations", function(x) x@chrom)
setGeneric("pos", function(x) standardGeneric("pos"))
setMethod("pos", "SNPLocations", function(x) x@pos)
genome(snplocs)  # just testing
## [1] "hg19"
snpid(snplocs)   # just testing
## [1] "rs0001" "rs0002"

Defining the show method

setMethod("show", "SNPLocations",
    function(object)
        cat(class(object), "instance with", length(object),
            "SNPs on genome", genome(object), "\n")
)
snplocs  # just testing
## SNPLocations instance with 2 SNPs on genome hg19

Defining the validity method

setValidity("SNPLocations",
    function(object) {
        if (!is.character(genome(object)) ||
            length(genome(object)) != 1 || is.na(genome(object)))
            return("'genome' slot must be a single string")
        slot_lengths <- c(length(snpid(object)),
                          length(chrom(object)),
                          length(pos(object)))
        if (length(unique(slot_lengths)) != 1)
            return("lengths of slots 'snpid', 'chrom' and 'pos' differ")
        TRUE
    }
)
snplocs@chrom <- LETTERS[1:3]  # a very bad idea!
validObject(snplocs)
## Error in `validObject()`:
## ! invalid class "SNPLocations" object: lengths of slots 'snpid', 'chrom' and 'pos' differ

Defining slot setters

setGeneric("chrom<-", function(x, value) standardGeneric("chrom<-"))
setReplaceMethod("chrom", "SNPLocations",
    function(x, value) {x@chrom <- value; validObject(x); x})
chrom(snplocs) <- LETTERS[1:2]  # repair currently broken object
chrom(snplocs) <- LETTERS[1:3]  # try to break it again
## Error in `validObject()`:
## ! invalid class "SNPLocations" object: lengths of slots 'snpid', 'chrom' and 'pos' differ

Defining a coercion method

setAs("SNPLocations", "data.frame",
    function(from)
        data.frame(snpid=snpid(from), chrom=chrom(from), pos=pos(from))
)
as(snplocs, "data.frame")  # testing
##    snpid chrom     pos
## 1 rs0001     A  224033
## 2 rs0002     B 1266886

Extending an existing class

Slot inheritance

  • Most of the time (but not always), the child class will have additional slots:
setClass("AnnotatedSNPs",
    contains="SNPLocations",
    slots=c(
        geneid="character"  # a character vector of length N
    )
)
  • The slots from the parent class are inherited:
showClass("AnnotatedSNPs")
## Class "AnnotatedSNPs" [in ".GlobalEnv"]
## 
## Slots:
##                                                         
## Name:     geneid    genome     snpid     chrom       pos
## Class: character character character character   integer
## 
## Extends: "SNPLocations"
  • Constructor:
AnnotatedSNPs <- function(genome, snpid, chrom, pos, geneid)
{
    new("AnnotatedSNPs",
        SNPLocations(genome, snpid, chrom, pos),
        geneid=geneid)
}

Method inheritance

  • Let’s create an AnnotatedSNPs object:
snps <- AnnotatedSNPs("hg19",
             c("rs0001", "rs0002"),
             c("chr1", "chrX"),
             c(224033L, 1266886L),
             c("AAU1", "SXW-23"))
  • All the methods defined for SNPLocations objects work out-of-the-box:
snps
## AnnotatedSNPs instance with 2 SNPs on genome hg19
  • But sometimes they don’t do the right thing:
as(snps, "data.frame")  # the 'geneid' slot is ignored
##    snpid chrom     pos
## 1 rs0001  chr1  224033
## 2 rs0002  chrX 1266886

  • Being a SNPLocations object vs being a SNPLocations instance:
is(snps, "AnnotatedSNPs")     # 'snps' is an AnnotatedSNPs object
## [1] TRUE
is(snps, "SNPLocations")      # and is also a SNPLocations object
## [1] TRUE
class(snps)                   # but is *not* a SNPLocations *instance*
## [1] "AnnotatedSNPs"
## attr(,"package")
## [1] ".GlobalEnv"
  • Method overriding: for example we could define a show method for AnnotatedSNPs objects. callNextMethod can be used in that context to call the method defined for the parent class from within the method for the child class.
  • Automatic coercion method:
as(snps, "SNPLocations")
## SNPLocations instance with 2 SNPs on genome hg19

Incremental validity method

  • The validity method for AnnotatedSNPs objects only needs to validate what’s not already validated by the validity method for SNPLocations objects:
setValidity("AnnotatedSNPs",
    function(object) {
        if (length(object@geneid) != length(object))
            return("'geneid' slot must have the length of the object")
        TRUE
    }
)
  • In other words: before an AnnotatedSNPs object can be considered valid, it must first be a valid SNPLocations object.

What else?

Other important S4 features

  • Virtual classes: equivalent to abstract classes in Java
  • Class unions (see ?setClassUnion)
  • Multiple inheritance: a powerful feature that should be used with caution. If used inappropriately, can lead to a class hierarchy that is very hard to maintain

Resources

  • Man pages in the methods package: ?setClass, ?showMethods, ?selectMethod, ?getMethod, ?is, ?setValidity, ?as
  • The Extending RangedSummarizedExperiment section of the SummarizedExperiment vignette in the SummarizedExperiment package.
  • Note: S4 is not covered in the An Introduction to R or The R language definition manuals
  • The Writing R Extensions manual for details about integrating S4 classes to a package
  • The R Programming for Bioinformatics book by Robert Gentleman