biodbMirbase 1.0.0
biodbMirbase is a biodb extension package that implements a connector to miRBase mature database (Griffiths-Jones et al. 2006, @griffithsjones2007_miRBase, @kozomara2010_miRBase, @kozomara2013_miRBase).
Install using Bioconductor:
if (!requireNamespace("BiocManager", quietly=TRUE))
    install.packages("BiocManager")
BiocManager::install('biodbMirbase')The first step in using biodbMirbase, is to create an instance of the biodb
class Biodb from the main biodb package. This is done by calling the
constructor of the class:
mybiodb <- biodb::newInst()During this step the configuration is set up, the cache system is initialized and extension packages are loaded.
We will see at the end of this vignette that the biodb instance needs to be
terminated with a call to the terminate() method.
In biodb the connection to a database is handled by a connector instance that you can get from the factory. biodbMirbase implements a connector to a remote database. Here is the code to instantiate a connector:
conn <- mybiodb$getFactory()$createConn('mirbase.mature')## Loading required package: biodbMirbaseTo get some of the first entry IDs (accession numbers) from the database, run:
ids <- conn$getEntryIds(2)## INFO  [16:06:03.158] Create cache folder "/home/biocbuild/.cache/R/biodb/mirbase.mature-ecbae556d51779d9d48125ba5a617e19" for "mirbase.mature-ecbae556d51779d9d48125ba5a617e19". 
## INFO  [16:06:03.160] Downloading whole database of mirbase.mature. 
## INFO  [16:06:06.940] Extract whole database of mirbase.mature.ids## [1] "MIMAT0000001" "MIMAT0000002"To retrieve entries, use:
entries <- conn$getEntry(ids)
entries## [[1]]
## Biodb miRBase mature database entry instance MIMAT0000001.
## 
## [[2]]
## Biodb miRBase mature database entry instance MIMAT0000002.To convert a list of entries into a dataframe, run:
x <- mybiodb$entriesToDataframe(entries)
x##      accession                     description         name
## 1 MIMAT0000001 Caenorhabditis elegans let-7-5p cel-let-7-5p
## 2 MIMAT0000002 Caenorhabditis elegans lin-4-5p cel-lin-4-5p
##                   aa.seq mirbase.mature.id
## 1 UGAGGUAGUAGGUUGUAUAGUU      MIMAT0000001
## 2  UCCCUGAGACCUCAAGUGUGA      MIMAT0000002When done with your biodb instance you have to terminate it, in order to ensure release of resources (file handles, database connection, etc):
mybiodb$terminate()## INFO  [16:06:10.656] Closing BiodbMain instance... 
## INFO  [16:06:10.658] Connector "mirbase.mature" deleted.sessionInfo()## R version 4.2.0 RC (2022-04-19 r82224)
## Platform: x86_64-pc-linux-gnu (64-bit)
## Running under: Ubuntu 20.04.4 LTS
## 
## Matrix products: default
## BLAS:   /home/biocbuild/bbs-3.15-bioc/R/lib/libRblas.so
## LAPACK: /home/biocbuild/bbs-3.15-bioc/R/lib/libRlapack.so
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
##  [3] LC_TIME=en_GB              LC_COLLATE=C              
##  [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
##  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
##  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] biodbMirbase_1.0.0 BiocStyle_2.24.0  
## 
## loaded via a namespace (and not attached):
##  [1] progress_1.2.2      tidyselect_1.1.2    xfun_0.30          
##  [4] bslib_0.3.1         purrr_0.3.4         vctrs_0.4.1        
##  [7] generics_0.1.2      htmltools_0.5.2     BiocFileCache_2.4.0
## [10] yaml_2.3.5          utf8_1.2.2          blob_1.2.3         
## [13] XML_3.99-0.9        rlang_1.0.2         jquerylib_0.1.4    
## [16] pillar_1.7.0        withr_2.5.0         glue_1.6.2         
## [19] DBI_1.1.2           rappdirs_0.3.3      bit64_4.0.5        
## [22] dbplyr_2.1.1        lifecycle_1.0.1     plyr_1.8.7         
## [25] stringr_1.4.0       memoise_2.0.1       evaluate_0.15      
## [28] knitr_1.38          fastmap_1.1.0       curl_4.3.2         
## [31] fansi_1.0.3         biodb_1.4.0         Rcpp_1.0.8.3       
## [34] openssl_2.0.0       filelock_1.0.2      BiocManager_1.30.17
## [37] cachem_1.0.6        jsonlite_1.8.0      bit_4.0.4          
## [40] hms_1.1.1           chk_0.8.0           askpass_1.1        
## [43] digest_0.6.29       stringi_1.7.6       bookdown_0.26      
## [46] dplyr_1.0.8         cli_3.3.0           tools_4.2.0        
## [49] magrittr_2.0.3      sass_0.4.1          RSQLite_2.2.12     
## [52] tibble_3.1.6        crayon_1.5.1        pkgconfig_2.0.3    
## [55] ellipsis_0.3.2      prettyunits_1.1.1   assertthat_0.2.1   
## [58] rmarkdown_2.14      httr_1.4.2          lgr_0.4.3          
## [61] R6_2.5.1            compiler_4.2.0Griffiths-Jones, Sam, Russell J. Grocock, Stijn van Dongen, Alex Bateman, and Anton J. Enright. 2006. “MiRBase: MicroRNA Sequences, Targets and Gene Nomenclature.” Nucleic Acids Research 34 (suppl_1): D140–D144. https://doi.org/10.1093/nar/gkj112.
Griffiths-Jones, Sam, Harpreet Kaur Saini, Stijn van Dongen, and Anton J. Enright. 2007. “miRBase: tools for microRNA genomics.” Nucleic Acids Research 36 (November): D154–D158. https://doi.org/10.1093/nar/gkm952.
Kozomara, Ana, and Sam Griffiths-Jones. 2010. “MiRBase: Integrating microRNA Annotation and Deep-Sequencing Data.” Nucleic Acids Research 39 (suppl_1): D152–D157. https://doi.org/10.1093/nar/gkq1027.
———. 2013. “MiRBase: Annotating High Confidence microRNAs Using Deep Sequencing Data.” Nucleic Acids Research 42 (D1): D68–D73. https://doi.org/10.1093/nar/gkt1181.