##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.22-bioc/R/bin/R CMD check --install=check:rfaRm.install-out.txt --library=/home/biocbuild/bbs-3.22-bioc/R/site-library --timings rfaRm_1.21.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/rfaRm.Rcheck’
* using R version 4.5.0 (2025-04-11)
* using platform: x86_64-pc-linux-gnu
* R was compiled by
    gcc (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
    GNU Fortran (Ubuntu 13.3.0-6ubuntu2~24.04) 13.3.0
* running under: Ubuntu 24.04.2 LTS
* using session charset: UTF-8
* checking for file ‘rfaRm/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘rfaRm’ version ‘1.21.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘rfaRm’ can be installed ... OK
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking code files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking whether startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
rfamSeedAlignment: no visible global function definition for ‘as’
Undefined global functions or variables:
  as
Consider adding
  importFrom("methods", "as")
to your NAMESPACE file (and ensure that your DESCRIPTION Imports field
contains 'methods').
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘rfaRm-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: rfamSequenceSearch
> ### Title: Performs a sequence search of the Rfam database
> ### Aliases: rfamSequenceSearch
> 
> ### ** Examples
> 
> # Search the Rfam database for hits with a specific sequence, and store the
> # results in a nested list
> 
> searchHits <- rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCAC
+ GAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
Running sequence search query. This might take a long time.
Error in base::strsplit(x, ...) : non-character argument
Calls: rfamSequenceSearch ... lapply -> FUN -> strsplit -> strsplit -> <Anonymous>
Execution halted
Examples with CPU (user + system) or elapsed time > 5s
                            user system elapsed
rfamSecondaryStructurePlot 6.598  0.121   7.063
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘runTests.R’
 ERROR
Running the tests in ‘tests/runTests.R’ failed.
Last 13 lines of output:
  
   
  1 Test Suite : 
  rfaRm RUnit Tests - 1 test function, 1 error, 0 failures
  ERROR in /tmp/RtmpUFcfJt/RLIBS_2a3c61306c5b7f/rfaRm/unitTests/test_searchFunctions.R: Error while sourcing  /tmp/RtmpUFcfJt/RLIBS_2a3c61306c5b7f/rfaRm/unitTests/test_searchFunctions.R : Error in base::strsplit(x, ...) : non-character argument
  
  Test files with failing tests
  
     test_searchFunctions.R 
       /tmp/RtmpUFcfJt/RLIBS_2a3c61306c5b7f/rfaRm/unitTests/test_searchFunctions.R 
  
  
  Error in BiocGenerics:::testPackage("rfaRm") : 
    unit tests failed for package rfaRm
  Execution halted
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes ... OK
* checking re-building of vignette outputs ... ERROR
Error(s) in re-building vignettes:
--- re-building ‘rfaRm.Rmd’ using rmarkdown
Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-2'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.

Warning in eng_r(options) :
  Failed to tidy R code in chunk 'unnamed-chunk-3'. Reason:
Error : The formatR package is required by the chunk option tidy = TRUE but not installed; tidy = TRUE will be ignored.


Quitting from rfaRm.Rmd:73-83 [unnamed-chunk-3]
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
<error/rlang_error>
Error in `base::strsplit()`:
! non-character argument
---
Backtrace:
    ▆
 1. └─rfaRm::rfamSequenceSearch("GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGUAUUUGCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC")
 2.   └─rfaRm:::rfamRetrieveSequenceSearchResult2(...)
 3.     ├─BiocGenerics::lapply(...)
 4.     └─base::lapply(...)
 5.       └─rfaRm (local) FUN(X[[i]], ...)
 6.         ├─Biostrings::strsplit(alignment, "\n")
 7.         └─Biostrings::strsplit(alignment, "\n")
 8.           └─base::strsplit(x, ...)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Error: processing vignette 'rfaRm.Rmd' failed with diagnostics:
non-character argument
--- failed re-building ‘rfaRm.Rmd’

SUMMARY: processing the following file failed:
  ‘rfaRm.Rmd’

Error: Vignette re-building failed.
Execution halted

* checking PDF version of manual ... OK
* DONE

Status: 3 ERRORs, 1 NOTE
See
  ‘/home/biocbuild/bbs-3.22-bioc/meat/rfaRm.Rcheck/00check.log’
for details.