############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/R/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/R/R/site-library --no-vignettes --timings FLAMES_2.3.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck’ * using R version 4.5.0 (2025-04-11) * using platform: aarch64-unknown-linux-gnu * R was compiled by aarch64-unknown-linux-gnu-gcc (GCC) 14.2.0 GNU Fortran (GCC) 14.2.0 * running under: openEuler 24.03 (LTS) * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * this is package ‘FLAMES’ version ‘2.3.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... INFO Imports includes 46 non-default packages. Importing from so many packages makes the package vulnerable to any of them becoming unavailable. Move as many as possible to Suggests and use conditionally. * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘aarch64-unknown-linux-gnu-g++ (GCC) 14.2.0’ * checking C++ specification ... OK * checking installed package size ... INFO installed size is 5.3Mb sub-directories of 1Mb or more: data 2.7Mb libs 1.4Mb * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking code files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE addRowRanges: no visible global function definition for ‘head’ chisq_test_by_gene: no visible global function definition for ‘chisq.test’ create_spe: no visible binding for global variable ‘barcode’ create_spe: no visible binding for global variable ‘in_tissue’ filter_coverage: no visible global function definition for ‘starts_with’ filter_coverage: no visible binding for global variable ‘filter_res’ find_barcode: no visible binding for global variable ‘Sample’ find_barcode: no visible binding for global variable ‘Outfile’ find_variants_grange: no visible binding for global variable ‘which_label’ find_variants_grange: no visible binding for global variable ‘nucleotide’ find_variants_grange: no visible binding for global variable ‘pos’ find_variants_grange: no visible binding for global variable ‘count’ find_variants_grange: no visible binding for global variable ‘counts_no_ins’ find_variants_grange: no visible binding for global variable ‘ref’ generate_sc_sce: no visible binding for global variable ‘FSM_match’ get_coverage: no visible binding for global variable ‘Freq’ homopolymer_pct : : no visible binding for global variable ‘Freq’ homopolymer_pct : : no visible binding for global variable ‘pct’ plot_coverage: no visible binding for global variable ‘tr_length’ plot_coverage: no visible binding for global variable ‘read_counts’ plot_coverage: no visible binding for global variable ‘total_counts’ plot_coverage: no visible binding for global variable ‘cumpct’ plot_coverage: no visible binding for global variable ‘length_bin’ plot_coverage: no visible binding for global variable ‘min_length’ plot_coverage: no visible binding for global variable ‘max_length’ plot_coverage: no visible global function definition for ‘head’ plot_coverage: no visible binding for global variable ‘transcript’ plot_demultiplex: no visible binding for global variable ‘CellBarcode’ plot_demultiplex: no visible binding for global variable ‘Sample’ plot_demultiplex: no visible binding for global variable ‘UMI’ plot_demultiplex: no visible binding for global variable ‘UMI_count’ plot_demultiplex: no visible binding for global variable ‘barcode_rank’ plot_demultiplex: no visible binding for global variable ‘FlankEditDist’ plot_demultiplex: no visible binding for global variable ‘n_reads’ plot_demultiplex: no visible binding for global variable ‘BarcodeEditDist’ plot_demultiplex: no visible binding for global variable ‘total reads’ plot_demultiplex: no visible binding for global variable ‘demultiplexed reads’ plot_demultiplex: no visible binding for global variable ‘single match reads’ plot_demultiplex: no visible binding for global variable ‘undemultiplexted reads’ plot_demultiplex: no visible binding for global variable ‘multi-matching reads’ plot_demultiplex: no visible binding for global variable ‘Type’ plot_demultiplex: no visible binding for global variable ‘Reads’ plot_demultiplex: no visible binding for global variable ‘input’ plot_demultiplex: no visible binding for global variable ‘output’ plot_demultiplex: no visible binding for global variable ‘read1_with_adapter’ plot_demultiplex: no visible binding for global variable ‘Count’ plot_flagstat: no visible global function definition for ‘everything’ plot_flagstat: no visible binding for global variable ‘name’ plot_flagstat: no visible binding for global variable ‘value’ plot_isoform_reduced_dim: no visible binding for global variable ‘x’ plot_isoform_reduced_dim: no visible binding for global variable ‘y’ plot_isoform_reduced_dim: no visible binding for global variable ‘expr’ plot_spatial: no visible binding for global variable ‘imageX’ plot_spatial: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘imageX’ plot_spatial_feature: no visible binding for global variable ‘imageY’ plot_spatial_feature: no visible binding for global variable ‘x’ plot_spatial_feature: no visible binding for global variable ‘y’ plot_spatial_feature: no visible global function definition for ‘scale_alpha_continuous’ plot_spatial_feature: no visible global function definition for ‘scale_colour_gradient’ plot_spatial_isoform: no visible global function definition for ‘head’ plot_spatial_pie: no visible global function definition for ‘head’ plot_spatial_pie: no visible binding for global variable ‘imageX’ plot_spatial_pie: no visible binding for global variable ‘imageY’ sc_mutations: no visible binding for global variable ‘mutation_index’ sc_mutations: no visible binding for global variable ‘bam_index’ sc_transcript_usage_chisq: no visible binding for global variable ‘p.value’ sc_transcript_usage_chisq: no visible binding for global variable ‘adj.p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘total’ sc_transcript_usage_permutation: no visible binding for global variable ‘test’ sc_transcript_usage_permutation : : : no visible global function definition for ‘na.omit’ sc_transcript_usage_permutation: no visible binding for global variable ‘transcript’ sc_transcript_usage_permutation: no visible binding for global variable ‘p.value’ sc_transcript_usage_permutation: no visible binding for global variable ‘adj.p.value’ variant_count_tb: no visible binding for global variable ‘barcode’ variant_count_tb: no visible binding for global variable ‘allele_count’ variant_count_tb: no visible binding for global variable ‘cell_total_reads’ Undefined global functions or variables: BarcodeEditDist CellBarcode Count FSM_match FlankEditDist Freq Outfile Reads Sample Type UMI UMI_count adj.p.value allele_count bam_index barcode barcode_rank cell_total_reads chisq.test count counts_no_ins cumpct demultiplexed reads everything expr filter_res head imageX imageY in_tissue input length_bin max_length min_length multi-matching reads mutation_index n_reads na.omit name nucleotide output p.value pct pos read1_with_adapter read_counts ref scale_alpha_continuous scale_colour_gradient single match reads starts_with test total total reads total_counts tr_length transcript undemultiplexted reads value which_label x y Consider adding importFrom("base", "match", "single") importFrom("stats", "chisq.test", "na.omit") importFrom("utils", "head") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... NOTE Found the following Rd file(s) with Rd \link{} targets missing package anchors: bulk_long_pipeline.Rd: SummarizedExperiment sc_long_multisample_pipeline.Rd: SingleCellExperiment sc_long_pipeline.Rd: SingleCellExperiment Please provide package anchors for all Rd \link{} targets not in the package itself and the base packages. * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... INFO GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available File ‘/home/biocbuild/R/R-4.5.0/site-library/FLAMES/libs/FLAMES.so’: Found ‘abort’, possibly from ‘abort’ (C) Found ‘exit’, possibly from ‘exit’ (C) Found ‘stderr’, possibly from ‘stderr’ (C) Found ‘stdout’, possibly from ‘stdout’ (C) Compiled code should not call entry points which might terminate R nor write to stdout/stderr instead of to the console, nor use Fortran I/O nor system RNGs nor [v]sprintf. The detected symbols are linked into the code but might come from libraries and not actually be called. See ‘Writing portable packages’ in the ‘Writing R Extensions’ manual. * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘FLAMES-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: bulk_long_pipeline > ### Title: Pipeline for Bulk Data > ### Aliases: bulk_long_pipeline > > ### ** Examples > > # download the two fastq files, move them to a folder to be merged together > temp_path <- tempfile() > bfc <- BiocFileCache::BiocFileCache(temp_path, ask = FALSE) > file_url <- + "https://raw.githubusercontent.com/OliverVoogd/FLAMESData/master/data" > # download the required fastq files, and move them to new folder > fastq1 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq1", paste(file_url, "fastq/sample1.fastq.gz", sep = "/")))]] > fastq2 <- bfc[[names(BiocFileCache::bfcadd(bfc, "Fastq2", paste(file_url, "fastq/sample2.fastq.gz", sep = "/")))]] > annotation <- bfc[[names(BiocFileCache::bfcadd(bfc, "annot.gtf", paste(file_url, "SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf", sep = "/")))]] > genome_fa <- bfc[[names(BiocFileCache::bfcadd(bfc, "genome.fa", paste(file_url, "SIRV_isoforms_multi-fasta_170612a.fasta", sep = "/")))]] > fastq_dir <- paste(temp_path, "fastq_dir", sep = "/") # the downloaded fastq files need to be in a directory to be merged together > dir.create(fastq_dir) > file.copy(c(fastq1, fastq2), fastq_dir) [1] TRUE TRUE > unlink(c(fastq1, fastq2)) # the original files can be deleted > > outdir <- tempfile() > dir.create(outdir) > se <- bulk_long_pipeline( + annotation = annotation, fastq = fastq_dir, outdir = outdir, genome_fa = genome_fa, + config_file = create_config(outdir, type = "sc_3end", threads = 1, no_flank = TRUE) + ) Writing configuration parameters to: /home/biocbuild/tmp/RtmpDg0jGx/file51521120fe0ac/config_file_333089.json #### Input parameters: { "pipeline_parameters": { "seed": [2022], "threads": [1], "do_barcode_demultiplex": [true], "do_gene_quantification": [true], "do_genome_alignment": [true], "do_isoform_identification": [true], "bambu_isoform_identification": [false], "multithread_isoform_identification": [false], "do_read_realignment": [true], "do_transcript_quantification": [true], "oarfish_quantification": [true] }, "barcode_parameters": { "max_bc_editdistance": [2], "max_flank_editdistance": [8], "pattern": { "primer": ["CTACACGACGCTCTTCCGATCT"], "BC": ["NNNNNNNNNNNNNNNN"], "UMI": ["NNNNNNNNNNNN"], "polyT": ["TTTTTTTTT"] }, "strand": ["-"], "TSO_seq": ["AAGCAGTGGTATCAACGCAGAGTACATGGG"], "TSO_prime": [5], "cutadapt_minimum_length": [10], "full_length_only": [false] }, "isoform_parameters": { "generate_raw_isoform": [false], "max_dist": [10], "max_ts_dist": [100], "max_splice_match_dist": [10], "min_fl_exon_len": [40], "max_site_per_splice": [3], "min_sup_cnt": [5], "min_cnt_pct": [0.001], "min_sup_pct": [0.2], "bambu_ndr": [0.5], "bambu_verbose": [false], "bambu_trust_reference": [true], "strand_specific": [0], "remove_incomp_reads": [4], "downsample_ratio": [1] }, "alignment_parameters": { "use_junctions": [true], "no_flank": [true] }, "realign_parameters": { "use_annotation": [true] }, "transcript_counting": { "min_tr_coverage": [0.4], "min_read_coverage": [0.4] } } gene annotation: /home/biocbuild/tmp/RtmpDg0jGx/file51521639f5f0e/5152174795640_SIRV_isoforms_multi-fasta-annotation_C_170612a.gtf genome fasta: /home/biocbuild/tmp/RtmpDg0jGx/file51521639f5f0e/51521742ff312_SIRV_isoforms_multi-fasta_170612a.fasta input fastq files: /home/biocbuild/tmp/RtmpDg0jGx/file51521639f5f0e/fastq_dir/5152117038c04_sample2.fastq.gz /home/biocbuild/tmp/RtmpDg0jGx/file51521639f5f0e/fastq_dir/515212598f5b_sample1.fastq.gz output directory: /home/biocbuild/tmp/RtmpDg0jGx/file51521120fe0ac minimap2 path: k8 path: #### Aligning reads to genome using minimap2 Aligning sample 5152117038c04_sample2 ... 06:38:51 Fri May 30 2025 minimap2_align Using Python: /home/biocbuild/.pyenv/versions/3.8.15/bin/python3.8 Creating virtual environment '/home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env' ... + /home/biocbuild/.pyenv/versions/3.8.15/bin/python3.8 -m venv /home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env Done! Installing packages: pip, wheel, setuptools + /home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env/bin/python -m pip install --upgrade pip wheel setuptools Requirement already satisfied: pip in /home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env/lib/python3.8/site-packages (22.0.4) Collecting pip Using cached pip-25.0.1-py3-none-any.whl (1.8 MB) Collecting wheel Using cached wheel-0.45.1-py3-none-any.whl (72 kB) Requirement already satisfied: setuptools in /home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env/lib/python3.8/site-packages (56.0.0) Collecting setuptools Using cached setuptools-75.3.2-py3-none-any.whl (1.3 MB) Installing collected packages: wheel, setuptools, pip Attempting uninstall: setuptools Found existing installation: setuptools 56.0.0 Uninstalling setuptools-56.0.0: Successfully uninstalled setuptools-56.0.0 Attempting uninstall: pip Found existing installation: pip 22.0.4 Uninstalling pip-22.0.4: Successfully uninstalled pip-22.0.4 Successfully installed pip-25.0.1 setuptools-75.3.2 wheel-0.45.1 Installing packages: 'oarfish==0.6.2', 'minimap2==2.28', 'samtools==1.21', 'k8==1.2' + /home/biocbuild/.cache/R/basilisk/1.21.5/FLAMES/2.3.0/bins_env/bin/python -m pip install --upgrade --no-user 'oarfish==0.6.2' 'minimap2==2.28' 'samtools==1.21' 'k8==1.2' ERROR: Could not find a version that satisfies the requirement oarfish==0.6.2 (from versions: none) ERROR: No matching distribution found for oarfish==0.6.2 Error: Error installing package(s): "'oarfish==0.6.2'", "'minimap2==2.28'", "'samtools==1.21'", "'k8==1.2'" Execution halted * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 1 ERROR, 4 NOTEs See ‘/home/biocbuild/bbs-3.22-bioc/meat/FLAMES.Rcheck/00check.log’ for details.